ID: 1047572216 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:126111355-126111377 |
| Sequence | CCAAGGAAGTGGGTGTGGGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047572216_1047572225 | 27 | Left | 1047572216 | 8:126111355-126111377 | CCAACCCACACCCACTTCCTTGG | No data | ||
| Right | 1047572225 | 8:126111405-126111427 | GCTGTATTTGCGAAGTAACAGGG | No data | ||||
| 1047572216_1047572224 | 26 | Left | 1047572216 | 8:126111355-126111377 | CCAACCCACACCCACTTCCTTGG | No data | ||
| Right | 1047572224 | 8:126111404-126111426 | TGCTGTATTTGCGAAGTAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047572216 | Original CRISPR | CCAAGGAAGTGGGTGTGGGT TGG (reversed) | Intergenic | ||