ID: 1047572216

View in Genome Browser
Species Human (GRCh38)
Location 8:126111355-126111377
Sequence CCAAGGAAGTGGGTGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047572216_1047572225 27 Left 1047572216 8:126111355-126111377 CCAACCCACACCCACTTCCTTGG No data
Right 1047572225 8:126111405-126111427 GCTGTATTTGCGAAGTAACAGGG No data
1047572216_1047572224 26 Left 1047572216 8:126111355-126111377 CCAACCCACACCCACTTCCTTGG No data
Right 1047572224 8:126111404-126111426 TGCTGTATTTGCGAAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047572216 Original CRISPR CCAAGGAAGTGGGTGTGGGT TGG (reversed) Intergenic