ID: 1047575692

View in Genome Browser
Species Human (GRCh38)
Location 8:126152105-126152127
Sequence ACTATATTCTGAGGCATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047575689_1047575692 26 Left 1047575689 8:126152056-126152078 CCACAGAATACATTCTTCTCATT No data
Right 1047575692 8:126152105-126152127 ACTATATTCTGAGGCATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047575692 Original CRISPR ACTATATTCTGAGGCATAAA TGG Intergenic
No off target data available for this crispr