ID: 1047576691

View in Genome Browser
Species Human (GRCh38)
Location 8:126163613-126163635
Sequence TCTCACTCTGTCACTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047576690_1047576691 24 Left 1047576690 8:126163566-126163588 CCTGAAATTTTAATCATGGTTAA No data
Right 1047576691 8:126163613-126163635 TCTCACTCTGTCACTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047576691 Original CRISPR TCTCACTCTGTCACTTAAGC TGG Intergenic
No off target data available for this crispr