ID: 1047581565

View in Genome Browser
Species Human (GRCh38)
Location 8:126222099-126222121
Sequence TGGGATTCCATGAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047581563_1047581565 -10 Left 1047581563 8:126222086-126222108 CCTCTTTTAATTTTGGGATTCCA No data
Right 1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047581565 Original CRISPR TGGGATTCCATGAGGAAAAC AGG Intergenic
No off target data available for this crispr