ID: 1047583577

View in Genome Browser
Species Human (GRCh38)
Location 8:126243905-126243927
Sequence CAGGCTACTCTCCTTGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047583575_1047583577 8 Left 1047583575 8:126243874-126243896 CCATGTCAGACAATGAAATTAAT No data
Right 1047583577 8:126243905-126243927 CAGGCTACTCTCCTTGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047583577 Original CRISPR CAGGCTACTCTCCTTGAACG AGG Intergenic
No off target data available for this crispr