ID: 1047594660

View in Genome Browser
Species Human (GRCh38)
Location 8:126366234-126366256
Sequence TTGTGGGGAAGAAGGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047594654_1047594660 -10 Left 1047594654 8:126366221-126366243 CCACGTAAATGCATTGTGGGGAA No data
Right 1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047594660 Original CRISPR TTGTGGGGAAGAAGGGGGGA AGG Intergenic
No off target data available for this crispr