ID: 1047595481

View in Genome Browser
Species Human (GRCh38)
Location 8:126373725-126373747
Sequence CCTATTTTATTGTGTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047595481_1047595485 27 Left 1047595481 8:126373725-126373747 CCTGAGCAACACAATAAAATAGG No data
Right 1047595485 8:126373775-126373797 GAGAAAGTTGAGGCACAAAGAGG No data
1047595481_1047595484 17 Left 1047595481 8:126373725-126373747 CCTGAGCAACACAATAAAATAGG No data
Right 1047595484 8:126373765-126373787 TTTTACAGATGAGAAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047595481 Original CRISPR CCTATTTTATTGTGTTGCTC AGG (reversed) Intergenic
No off target data available for this crispr