ID: 1047595608

View in Genome Browser
Species Human (GRCh38)
Location 8:126374880-126374902
Sequence GTTTATTTACAAAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047595597_1047595608 29 Left 1047595597 8:126374828-126374850 CCATCACCCACCTCCGGTCTCTA No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595596_1047595608 30 Left 1047595596 8:126374827-126374849 CCCATCACCCACCTCCGGTCTCT No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595598_1047595608 23 Left 1047595598 8:126374834-126374856 CCCACCTCCGGTCTCTAGATAAC No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595605_1047595608 -5 Left 1047595605 8:126374862-126374884 CCTGGAGATATGTCCAGGGTTTA No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595601_1047595608 16 Left 1047595601 8:126374841-126374863 CCGGTCTCTAGATAACAGCTGCC No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595599_1047595608 22 Left 1047595599 8:126374835-126374857 CCACCTCCGGTCTCTAGATAACA No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data
1047595600_1047595608 19 Left 1047595600 8:126374838-126374860 CCTCCGGTCTCTAGATAACAGCT No data
Right 1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047595608 Original CRISPR GTTTATTTACAAAAGATGGC TGG Intergenic
No off target data available for this crispr