ID: 1047595834

View in Genome Browser
Species Human (GRCh38)
Location 8:126377060-126377082
Sequence ATTCTCCTCTAGAAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047595834_1047595838 17 Left 1047595834 8:126377060-126377082 CCCTCACTTTTCTAGAGGAGAAT No data
Right 1047595838 8:126377100-126377122 CCCTATTAATTTCACTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047595834 Original CRISPR ATTCTCCTCTAGAAAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr