ID: 1047599850

View in Genome Browser
Species Human (GRCh38)
Location 8:126415008-126415030
Sequence CTTTTGTACCCATTGTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047599850_1047599854 7 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599854 8:126415038-126415060 ATGTAAGGGGAAACATTCTCAGG No data
1047599850_1047599853 -6 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599853 8:126415025-126415047 CAAAAGCAACAGAATGTAAGGGG No data
1047599850_1047599852 -7 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599852 8:126415024-126415046 ACAAAAGCAACAGAATGTAAGGG No data
1047599850_1047599855 11 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG No data
1047599850_1047599851 -8 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599851 8:126415023-126415045 TACAAAAGCAACAGAATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047599850 Original CRISPR CTTTTGTACCCATTGTCTTC TGG (reversed) Intergenic
No off target data available for this crispr