ID: 1047599855

View in Genome Browser
Species Human (GRCh38)
Location 8:126415042-126415064
Sequence AAGGGGAAACATTCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047599850_1047599855 11 Left 1047599850 8:126415008-126415030 CCAGAAGACAATGGGTACAAAAG No data
Right 1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047599855 Original CRISPR AAGGGGAAACATTCTCAGGA AGG Intergenic
No off target data available for this crispr