ID: 1047607691

View in Genome Browser
Species Human (GRCh38)
Location 8:126491168-126491190
Sequence CAATATCTGTGATGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047607688_1047607691 -6 Left 1047607688 8:126491151-126491173 CCATGTCTATCTGGGCACAATAT No data
Right 1047607691 8:126491168-126491190 CAATATCTGTGATGGGAAATAGG No data
1047607685_1047607691 10 Left 1047607685 8:126491135-126491157 CCTACAGTCACTATTTCCATGTC No data
Right 1047607691 8:126491168-126491190 CAATATCTGTGATGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047607691 Original CRISPR CAATATCTGTGATGGGAAAT AGG Intergenic
No off target data available for this crispr