ID: 1047607691 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:126491168-126491190 |
| Sequence | CAATATCTGTGATGGGAAAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047607688_1047607691 | -6 | Left | 1047607688 | 8:126491151-126491173 | CCATGTCTATCTGGGCACAATAT | No data | ||
| Right | 1047607691 | 8:126491168-126491190 | CAATATCTGTGATGGGAAATAGG | No data | ||||
| 1047607685_1047607691 | 10 | Left | 1047607685 | 8:126491135-126491157 | CCTACAGTCACTATTTCCATGTC | No data | ||
| Right | 1047607691 | 8:126491168-126491190 | CAATATCTGTGATGGGAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047607691 | Original CRISPR | CAATATCTGTGATGGGAAAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||