ID: 1047610811

View in Genome Browser
Species Human (GRCh38)
Location 8:126518973-126518995
Sequence CCAGCTGAGCAGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047610801_1047610811 4 Left 1047610801 8:126518946-126518968 CCTGGCACCTGATCCTCCAGACA No data
Right 1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG No data
1047610803_1047610811 -9 Left 1047610803 8:126518959-126518981 CCTCCAGACAAGCCCCAGCTGAG No data
Right 1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG No data
1047610799_1047610811 23 Left 1047610799 8:126518927-126518949 CCAGCGTCTTTACGCGTTTCCTG No data
Right 1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG No data
1047610802_1047610811 -3 Left 1047610802 8:126518953-126518975 CCTGATCCTCCAGACAAGCCCCA No data
Right 1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047610811 Original CRISPR CCAGCTGAGCAGAGGGGAGA AGG Intergenic
No off target data available for this crispr