ID: 1047614489

View in Genome Browser
Species Human (GRCh38)
Location 8:126552038-126552060
Sequence ACCCATTTTCTGTAATTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614482_1047614489 26 Left 1047614482 8:126551989-126552011 CCACTGGCACCTGCATCCCTTAT No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614484_1047614489 10 Left 1047614484 8:126552005-126552027 CCCTTATGCCAACAGTGCCGTGC No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614486_1047614489 2 Left 1047614486 8:126552013-126552035 CCAACAGTGCCGTGCCACTATGT No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614483_1047614489 17 Left 1047614483 8:126551998-126552020 CCTGCATCCCTTATGCCAACAGT No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614485_1047614489 9 Left 1047614485 8:126552006-126552028 CCTTATGCCAACAGTGCCGTGCC No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614481_1047614489 30 Left 1047614481 8:126551985-126552007 CCAACCACTGGCACCTGCATCCC No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data
1047614487_1047614489 -7 Left 1047614487 8:126552022-126552044 CCGTGCCACTATGTTCACCCATT No data
Right 1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614489 Original CRISPR ACCCATTTTCTGTAATTATG TGG Intergenic
No off target data available for this crispr