ID: 1047614846 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:126555943-126555965 |
| Sequence | GTATGGGATCCAGGAGGCTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 365 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 42, 4: 322} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047614846_1047614855 | 20 | Left | 1047614846 | 8:126555943-126555965 | CCCCAGCCTCCTGGATCCCATAC | 0: 1 1: 0 2: 0 3: 42 4: 322 |
||
| Right | 1047614855 | 8:126555986-126556008 | CAGACAAGCAGCTTTCGTGCTGG | 0: 1 1: 0 2: 0 3: 9 4: 74 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047614846 | Original CRISPR | GTATGGGATCCAGGAGGCTG GGG (reversed) | Exonic | ||