ID: 1047614846

View in Genome Browser
Species Human (GRCh38)
Location 8:126555943-126555965
Sequence GTATGGGATCCAGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614846_1047614855 20 Left 1047614846 8:126555943-126555965 CCCCAGCCTCCTGGATCCCATAC 0: 1
1: 0
2: 0
3: 42
4: 322
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614846 Original CRISPR GTATGGGATCCAGGAGGCTG GGG (reversed) Exonic