ID: 1047614848

View in Genome Browser
Species Human (GRCh38)
Location 8:126555945-126555967
Sequence GTGTATGGGATCCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614848_1047614855 18 Left 1047614848 8:126555945-126555967 CCAGCCTCCTGGATCCCATACAC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614848_1047614856 29 Left 1047614848 8:126555945-126555967 CCAGCCTCCTGGATCCCATACAC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614848 Original CRISPR GTGTATGGGATCCAGGAGGC TGG (reversed) Exonic