ID: 1047614849

View in Genome Browser
Species Human (GRCh38)
Location 8:126555949-126555971
Sequence AGCTGTGTATGGGATCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614849_1047614856 25 Left 1047614849 8:126555949-126555971 CCTCCTGGATCCCATACACAGCT 0: 1
1: 0
2: 1
3: 19
4: 196
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614849_1047614855 14 Left 1047614849 8:126555949-126555971 CCTCCTGGATCCCATACACAGCT 0: 1
1: 0
2: 1
3: 19
4: 196
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614849 Original CRISPR AGCTGTGTATGGGATCCAGG AGG (reversed) Exonic