ID: 1047614850

View in Genome Browser
Species Human (GRCh38)
Location 8:126555952-126555974
Sequence CTGAGCTGTGTATGGGATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614850_1047614856 22 Left 1047614850 8:126555952-126555974 CCTGGATCCCATACACAGCTCAG 0: 1
1: 1
2: 1
3: 12
4: 153
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614850_1047614855 11 Left 1047614850 8:126555952-126555974 CCTGGATCCCATACACAGCTCAG 0: 1
1: 1
2: 1
3: 12
4: 153
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614850 Original CRISPR CTGAGCTGTGTATGGGATCC AGG (reversed) Exonic