ID: 1047614852

View in Genome Browser
Species Human (GRCh38)
Location 8:126555960-126555982
Sequence TGGCGGAGCTGAGCTGTGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614852_1047614855 3 Left 1047614852 8:126555960-126555982 CCATACACAGCTCAGCTCCGCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614852_1047614856 14 Left 1047614852 8:126555960-126555982 CCATACACAGCTCAGCTCCGCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614852 Original CRISPR TGGCGGAGCTGAGCTGTGTA TGG (reversed) Exonic