ID: 1047614854

View in Genome Browser
Species Human (GRCh38)
Location 8:126555980-126556002
Sequence CGAAAGCTGCTTGTCTGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614854_1047614856 -6 Left 1047614854 8:126555980-126556002 CCAAAGCAGACAAGCAGCTTTCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614854_1047614862 29 Left 1047614854 8:126555980-126556002 CCAAAGCAGACAAGCAGCTTTCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1047614862 8:126556032-126556054 CCCACTCTGGCCTTTCTACCAGG 0: 1
1: 0
2: 4
3: 21
4: 222
1047614854_1047614859 16 Left 1047614854 8:126555980-126556002 CCAAAGCAGACAAGCAGCTTTCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1047614859 8:126556019-126556041 GCGACTCCACAAACCCACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614854 Original CRISPR CGAAAGCTGCTTGTCTGCTT TGG (reversed) Exonic