ID: 1047614855

View in Genome Browser
Species Human (GRCh38)
Location 8:126555986-126556008
Sequence CAGACAAGCAGCTTTCGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614852_1047614855 3 Left 1047614852 8:126555960-126555982 CCATACACAGCTCAGCTCCGCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614846_1047614855 20 Left 1047614846 8:126555943-126555965 CCCCAGCCTCCTGGATCCCATAC 0: 1
1: 0
2: 0
3: 42
4: 322
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614850_1047614855 11 Left 1047614850 8:126555952-126555974 CCTGGATCCCATACACAGCTCAG 0: 1
1: 1
2: 1
3: 12
4: 153
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614849_1047614855 14 Left 1047614849 8:126555949-126555971 CCTCCTGGATCCCATACACAGCT 0: 1
1: 0
2: 1
3: 19
4: 196
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614847_1047614855 19 Left 1047614847 8:126555944-126555966 CCCAGCCTCCTGGATCCCATACA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614848_1047614855 18 Left 1047614848 8:126555945-126555967 CCAGCCTCCTGGATCCCATACAC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1047614851_1047614855 4 Left 1047614851 8:126555959-126555981 CCCATACACAGCTCAGCTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1047614855 8:126555986-126556008 CAGACAAGCAGCTTTCGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614855 Original CRISPR CAGACAAGCAGCTTTCGTGC TGG Exonic