ID: 1047614856

View in Genome Browser
Species Human (GRCh38)
Location 8:126555997-126556019
Sequence CTTTCGTGCTGGTCCCGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614847_1047614856 30 Left 1047614847 8:126555944-126555966 CCCAGCCTCCTGGATCCCATACA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614852_1047614856 14 Left 1047614852 8:126555960-126555982 CCATACACAGCTCAGCTCCGCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614849_1047614856 25 Left 1047614849 8:126555949-126555971 CCTCCTGGATCCCATACACAGCT 0: 1
1: 0
2: 1
3: 19
4: 196
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614848_1047614856 29 Left 1047614848 8:126555945-126555967 CCAGCCTCCTGGATCCCATACAC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614854_1047614856 -6 Left 1047614854 8:126555980-126556002 CCAAAGCAGACAAGCAGCTTTCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614851_1047614856 15 Left 1047614851 8:126555959-126555981 CCCATACACAGCTCAGCTCCGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614850_1047614856 22 Left 1047614850 8:126555952-126555974 CCTGGATCCCATACACAGCTCAG 0: 1
1: 1
2: 1
3: 12
4: 153
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1047614853_1047614856 -3 Left 1047614853 8:126555977-126555999 CCGCCAAAGCAGACAAGCAGCTT 0: 1
1: 0
2: 1
3: 23
4: 175
Right 1047614856 8:126555997-126556019 CTTTCGTGCTGGTCCCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614856 Original CRISPR CTTTCGTGCTGGTCCCGCAG TGG Exonic