ID: 1047614862

View in Genome Browser
Species Human (GRCh38)
Location 8:126556032-126556054
Sequence CCCACTCTGGCCTTTCTACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614858_1047614862 -2 Left 1047614858 8:126556011-126556033 CCGCAGTGGCGACTCCACAAACC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1047614862 8:126556032-126556054 CCCACTCTGGCCTTTCTACCAGG 0: 1
1: 0
2: 4
3: 21
4: 222
1047614854_1047614862 29 Left 1047614854 8:126555980-126556002 CCAAAGCAGACAAGCAGCTTTCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1047614862 8:126556032-126556054 CCCACTCTGGCCTTTCTACCAGG 0: 1
1: 0
2: 4
3: 21
4: 222
1047614857_1047614862 -1 Left 1047614857 8:126556010-126556032 CCCGCAGTGGCGACTCCACAAAC 0: 1
1: 0
2: 2
3: 7
4: 80
Right 1047614862 8:126556032-126556054 CCCACTCTGGCCTTTCTACCAGG 0: 1
1: 0
2: 4
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614862 Original CRISPR CCCACTCTGGCCTTTCTACC AGG Exonic