ID: 1047614918

View in Genome Browser
Species Human (GRCh38)
Location 8:126556280-126556302
Sequence CTGTGGACGGGGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1171
Summary {0: 1, 1: 0, 2: 3, 3: 109, 4: 1058}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047614918_1047614931 18 Left 1047614918 8:126556280-126556302 CCTTCCTCCTCCCCCGTCCACAG 0: 1
1: 0
2: 3
3: 109
4: 1058
Right 1047614931 8:126556321-126556343 AACTCTTTTCCAAAGGGCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 187
1047614918_1047614929 12 Left 1047614918 8:126556280-126556302 CCTTCCTCCTCCCCCGTCCACAG 0: 1
1: 0
2: 3
3: 109
4: 1058
Right 1047614929 8:126556315-126556337 TTCACCAACTCTTTTCCAAAGGG 0: 1
1: 0
2: 1
3: 31
4: 288
1047614918_1047614933 30 Left 1047614918 8:126556280-126556302 CCTTCCTCCTCCCCCGTCCACAG 0: 1
1: 0
2: 3
3: 109
4: 1058
Right 1047614933 8:126556333-126556355 AAGGGCCCAGGAATCCCAGATGG 0: 1
1: 0
2: 4
3: 21
4: 239
1047614918_1047614928 11 Left 1047614918 8:126556280-126556302 CCTTCCTCCTCCCCCGTCCACAG 0: 1
1: 0
2: 3
3: 109
4: 1058
Right 1047614928 8:126556314-126556336 TTTCACCAACTCTTTTCCAAAGG 0: 1
1: 0
2: 1
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047614918 Original CRISPR CTGTGGACGGGGGAGGAGGA AGG (reversed) Exonic
900009894 1:96428-96450 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900026006 1:273012-273034 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900035790 1:406869-406891 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900057412 1:642619-642641 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900232629 1:1568679-1568701 CTTTGGGAGGCGGAGGAGGACGG + Intronic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900515747 1:3081462-3081484 CTGTGGCCGTGTGAGGAGCAGGG + Intronic
900638242 1:3676048-3676070 CTGGGGACAGGGGACAAGGAGGG + Intronic
900702815 1:4058681-4058703 GCGTGGAGGGAGGAGGAGGAGGG + Intergenic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
901159065 1:7161278-7161300 CTGTGCAGGGTGGAGAAGGAGGG - Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901332783 1:8423763-8423785 CCGCTGACGGGGGAGGAGGCAGG + Intronic
901520282 1:9778670-9778692 CTATGGACGGGGGGAGAAGACGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902104002 1:14018359-14018381 CAGGGTACGGGGGAGAAGGAGGG + Intergenic
902129127 1:14243375-14243397 CTCTGGGAGGTGGAGGAGGAGGG + Intergenic
902620293 1:17646839-17646861 CAGTGGCCGAGGGAGGAGGCTGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903163162 1:21503490-21503512 CCGTGGGGGGGGGAGGGGGAGGG + Intergenic
903407078 1:23106813-23106835 CTGTGGAGGGTGGGGAAGGATGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
904118704 1:28181089-28181111 CTTTGGAAGGCGGAGGAGGGCGG - Intronic
904365586 1:30009095-30009117 CAGTGGCCGGGGGAGGGGGGCGG + Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904612866 1:31735096-31735118 CCATGGTGGGGGGAGGAGGAGGG - Intronic
904826063 1:33274549-33274571 CTGTGGATGGAGGAGCAGGGGGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905624011 1:39475005-39475027 CTCTGGACGGGTCAGCAGGAGGG + Intronic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
905775122 1:40663457-40663479 CTGGGGAGGGGGGAGCAGGCTGG - Intronic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
906148775 1:43575672-43575694 CTCTGCTCTGGGGAGGAGGAGGG - Intronic
906786285 1:48618819-48618841 CAGTGGTCGGGGGAGGAGTGGGG + Intronic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
907235990 1:53048212-53048234 TTGTGGTCAGGGGAGGATGAAGG + Intronic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908516442 1:64897455-64897477 AGGAGGACGAGGGAGGAGGAGGG + Intronic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909180710 1:72420335-72420357 CTGTGGTGGGGGGAGGGAGAGGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909339789 1:74519024-74519046 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910333018 1:86097568-86097590 AGGAGGAGGGGGGAGGAGGAGGG - Intronic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910686743 1:89925429-89925451 CCATGGACGGGGGAGGGGGATGG - Intronic
911667913 1:100575158-100575180 CTGTGGATGGGGGTAGAGGGTGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912664490 1:111566879-111566901 TTTTGGAGGGGGGAGGAGGAAGG + Intronic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913287698 1:117241691-117241713 CTCAGGAGGTGGGAGGAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913533196 1:119747720-119747742 GTGGGGGCAGGGGAGGAGGAGGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914723872 1:150311127-150311149 CTTTGGAAGGCCGAGGAGGATGG + Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915355613 1:155253922-155253944 CTCTGGACAGGGCCGGAGGAGGG + Exonic
916331051 1:163617524-163617546 CTGTGGCCTGGAGAGGAAGATGG + Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917345941 1:174028263-174028285 TTGTGGACTGGGGAGGAAGTAGG - Intergenic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917906450 1:179590901-179590923 CTGTGGGCGGGGGAGAGGGTTGG + Intergenic
917991931 1:180389146-180389168 TTGTGGGCGGGGGAGCGGGAAGG - Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
918820157 1:189243441-189243463 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
920002231 1:202807933-202807955 TTGAGGCCGGGGGAGGAAGACGG - Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920369519 1:205469298-205469320 CTGTGGGCTGGGGAAGGGGAAGG - Intergenic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
920968741 1:210723971-210723993 CTGTGGCCGGGGAAAGAGTATGG + Intronic
921108444 1:212008584-212008606 CTGACGTCGGGGCAGGAGGACGG - Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922224231 1:223631427-223631449 CTGGGGAGGTGTGAGGAGGAAGG - Intronic
922258324 1:223912435-223912457 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
922338098 1:224634020-224634042 CTGTGGTCTGGTGGGGAGGATGG + Intronic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923051983 1:230395756-230395778 GTGAGGAGGGGGGAGGAGGGTGG - Intronic
923052151 1:230396405-230396427 GTGGGGATGGGGGAGGAGGGTGG - Intronic
923997884 1:239517115-239517137 CTATGGACCGGGCAGGAGGATGG - Intronic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924339520 1:243015199-243015221 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
1062936853 10:1396606-1396628 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062936888 10:1396729-1396751 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062936912 10:1396811-1396833 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937108 10:1397508-1397530 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937166 10:1397713-1397735 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937214 10:1397877-1397899 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937227 10:1397918-1397940 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937250 10:1398000-1398022 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937262 10:1398041-1398063 CTCGGGAGGGGAGAGGAGGACGG - Intronic
1062937297 10:1398164-1398186 CTCGGGACGGGAGAGGAGGACGG - Intronic
1063213860 10:3906207-3906229 GGGTGGAAAGGGGAGGAGGAAGG + Intergenic
1063244360 10:4202983-4203005 GCATGGTCGGGGGAGGAGGAGGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063623367 10:7667644-7667666 GTGGGGACTGGGGAGGAGGCGGG - Intergenic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065046588 10:21751877-21751899 CTGTGGGCGGGGGGGGGGGGGGG + Intergenic
1065618401 10:27552318-27552340 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1065975208 10:30835823-30835845 GTGAGGCCGGGGGAGGAGAAGGG + Intronic
1065992564 10:31027091-31027113 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1066489550 10:35881757-35881779 CTTTGGAAGGCTGAGGAGGAAGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067413325 10:46084357-46084379 CTGTGGCCAGGGGAGAGGGAGGG + Intergenic
1067473871 10:46553918-46553940 CTGTGGACTGGGCCAGAGGAGGG + Intronic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1069159621 10:65078251-65078273 GTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069614976 10:69801365-69801387 CGGTTGTCGGGGGAGAAGGAAGG + Intergenic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1069720181 10:70544803-70544825 CTGTGCCCAGGGGAGTAGGAGGG - Intronic
1069997141 10:72349323-72349345 GTGGGGGCTGGGGAGGAGGAGGG + Intronic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073137301 10:101227145-101227167 CCGGGGACAGGGGAGGAGGCGGG + Exonic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073441487 10:103555283-103555305 GAGGAGACGGGGGAGGAGGAGGG + Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074852304 10:117448669-117448691 CTGTGGGAGGGGGACGGGGAGGG - Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076594432 10:131617243-131617265 CGGTGGCCGAGCGAGGAGGACGG - Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076859414 10:133133568-133133590 CAGGGGACGGGGTAGGGGGAGGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077477574 11:2797672-2797694 CGGGGCCCGGGGGAGGAGGAGGG - Intronic
1077761751 11:5107726-5107748 AGGGGGAGGGGGGAGGAGGAAGG + Intergenic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079376541 11:19897232-19897254 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1080136871 11:28865318-28865340 GTGTGGTCGGGGGAGGGGGGCGG + Intergenic
1080236445 11:30074184-30074206 CAATGGACGGGGAAGGAGGTTGG - Intergenic
1080317386 11:30965743-30965765 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1080464858 11:32487186-32487208 CTGTGGACTGGAGAGAAGGGAGG - Intergenic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1081268956 11:41060981-41061003 GTGTGGAGGGGGGAGGGGAAGGG - Intronic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081874194 11:46397580-46397602 ATGGGGACAGGGGAGGAAGAGGG + Exonic
1082849538 11:57753161-57753183 CCGAGGACTCGGGAGGAGGAGGG - Intronic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1083470610 11:62881503-62881525 CTGGGGACAGGGGAGGGGGTCGG - Intronic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1084153427 11:67301773-67301795 CCGTGGCCTGGGGAGGAGGGCGG - Exonic
1084155069 11:67308654-67308676 GTGTGGATGGGGGAGGAGAGTGG - Intronic
1084285656 11:68128831-68128853 ACGTGGACGGGGGTGGTGGATGG + Intergenic
1084443436 11:69189499-69189521 CTGGGGATGGGGGTGCAGGAGGG + Intergenic
1084484671 11:69440924-69440946 CTGTGGAAGGCGGAGAAGAAGGG + Intergenic
1084534997 11:69751299-69751321 CTGTGGGCTGGTGAGGAGGATGG + Intergenic
1084920319 11:72464423-72464445 GGGAGGAGGGGGGAGGAGGAGGG - Intergenic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086131591 11:83407458-83407480 CTGTGGCCGGGGGAGATGAAGGG + Intergenic
1086455668 11:86956299-86956321 CTGTGCACTGGGGACGAGGAAGG + Intergenic
1086797649 11:91127884-91127906 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1088573945 11:111251631-111251653 ATGTGGACAGGTTAGGAGGAAGG - Intergenic
1088711856 11:112515808-112515830 CTGTGGGCAGGGGAGGGGGGTGG - Intergenic
1089362179 11:117898203-117898225 CTTGGGACCGGGGTGGAGGAGGG + Intergenic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1090064106 11:123488668-123488690 GTGGCAACGGGGGAGGAGGAGGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090266699 11:125357739-125357761 CTGTGGTCTGAAGAGGAGGATGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090885829 11:130875693-130875715 GTGAGGTCGGGGGAGGGGGAAGG + Exonic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092180665 12:6444645-6444667 CTGTGGACGGGGGGGTGGGTGGG + Intergenic
1092385358 12:8032652-8032674 CGGCGGGCGGGGGAGGGGGAGGG + Intergenic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1093319204 12:17691841-17691863 GTGTGGTAGGGGGAGGAGGGAGG + Intergenic
1093323178 12:17739277-17739299 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1093404143 12:18784407-18784429 CTTTGGGAGGGTGAGGAGGATGG - Intergenic
1093747687 12:22761806-22761828 CTTTGGAAGGGTGAGGCGGAGGG + Intergenic
1093886871 12:24471604-24471626 ATGAGGATGGGGGAGGAGCAGGG + Intergenic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096439072 12:51623756-51623778 GTGGGGTGGGGGGAGGAGGAAGG - Intronic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096893344 12:54794438-54794460 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097546041 12:61002701-61002723 GTGGGGTCGGGGGAGGGGGAGGG - Intergenic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098176668 12:67799286-67799308 GTGTGGAAAGGGGAGGAGAAAGG - Intergenic
1098372318 12:69773553-69773575 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1098618698 12:72563797-72563819 CTGGGGGCGGGGGTGGGGGATGG + Intronic
1098905250 12:76155190-76155212 CTGTTCACGGGTGAGGAGAAAGG - Intergenic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1099566485 12:84254368-84254390 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1099733699 12:86539166-86539188 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101651878 12:106684675-106684697 CTGTGGGTGGGGGAGGAGCATGG - Intronic
1101705088 12:107214099-107214121 ATGGGGTCGGGGGAGGGGGAGGG + Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102201630 12:111061361-111061383 TTCGGGATGGGGGAGGAGGAGGG + Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102599329 12:114017281-114017303 TTGTGGGAGGGGGAGGAGGGAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103602216 12:122061573-122061595 CTGTGGTGGGGGGAGGGCGAGGG - Exonic
1103704257 12:122862774-122862796 CTGGGGTGGGGGGAGCAGGAGGG - Exonic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104793880 12:131502833-131502855 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1104929469 12:132330049-132330071 CCCTGGACGGGGGAGAGGGAGGG - Intergenic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105933031 13:25070040-25070062 CGGTTGCCGGGTGAGGAGGAAGG - Intergenic
1106049695 13:26178504-26178526 ATGTGGGCGGGGGTGGGGGAGGG + Intronic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106411222 13:29513011-29513033 ATGCTGATGGGGGAGGAGGAGGG - Exonic
1106571176 13:30929390-30929412 CTCTAGCCAGGGGAGGAGGAGGG - Intergenic
1107623523 13:42258956-42258978 TTGTGCACGGGGGAGGAGCCTGG + Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1107945612 13:45415505-45415527 CTTTGGAAGGTGGAGGAGGGTGG + Intronic
1108578212 13:51807220-51807242 CTGCGGAGTGGGGAGGAGGGTGG - Intergenic
1109189259 13:59306039-59306061 CTGTGGACGGAGGATGGGGGTGG - Intergenic
1110543897 13:76735536-76735558 CTGTGGAGGTGAGAGCAGGAAGG + Intergenic
1110678773 13:78283322-78283344 TTGTGGAGGGGGGAGGGGGGAGG - Intergenic
1112043655 13:95573867-95573889 CTGTTGTGGGGGGAGGAGGGAGG - Intronic
1112671226 13:101641704-101641726 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113834032 13:113317105-113317127 CTGTTGCCGGGAGAGGAGGAGGG + Intronic
1113905391 13:113817209-113817231 CTCTGGGCTGGAGAGGAGGAAGG - Intergenic
1113909854 13:113836645-113836667 ATAAGGATGGGGGAGGAGGAGGG + Intronic
1113995149 14:16058204-16058226 GGGTGGGCGGGCGAGGAGGATGG - Intergenic
1114484584 14:23055289-23055311 CTGTTGACCGGGGAGGGGGCAGG - Exonic
1114535877 14:23422134-23422156 TTATGGGCTGGGGAGGAGGAAGG + Intronic
1114547218 14:23512035-23512057 ATTGGGATGGGGGAGGAGGAAGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1115105277 14:29753607-29753629 CTCTGGGCTGGGGAGGAGAAAGG - Intronic
1115310061 14:31969893-31969915 CTGGGGGCGGGGGAAGAGGGAGG - Intergenic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116840943 14:49820628-49820650 CCGTGGAAGGGGGAGGAGAGAGG - Intronic
1117302286 14:54441400-54441422 CTGTGGCCGGGGGAAGTGAATGG - Exonic
1117837154 14:59819430-59819452 CTGTGGCCGGGGGGGGGGGGTGG - Intronic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118317892 14:64736920-64736942 CAGTGAGCGGGGGAGGAGGAGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118349818 14:64965746-64965768 CTGGGGAGCGGGGAGAAGGAAGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119476733 14:74934819-74934841 CTTTGAAAGGGAGAGGAGGAGGG + Intergenic
1119536243 14:75404737-75404759 ATGTGGACGGGAGAGGGGAAAGG + Intergenic
1119564526 14:75617072-75617094 CAGTGGATGGTGGAAGAGGATGG + Intronic
1119996657 14:79261105-79261127 CTGGGAAGGGGTGAGGAGGAGGG + Intronic
1120193424 14:81459945-81459967 GGGTGGATGGTGGAGGAGGAAGG - Intergenic
1120671414 14:87366643-87366665 CTTTGGAAGGCCGAGGAGGAGGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121599739 14:95194455-95194477 CTCTGGGCTGGGGAGGAGGAAGG + Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1121727779 14:96165778-96165800 CTGGGGATGGGGGAGAAGGTAGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121861468 14:97322909-97322931 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122327311 14:100890481-100890503 GTGAGGACAGGGGAGGAGGGTGG + Intergenic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1122885365 14:104708162-104708184 GTGGGGACGGGGGAGGAGCAGGG + Intronic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1123002173 14:105301369-105301391 CTGTGGGCGGGGGAAGGGGGCGG + Exonic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123986280 15:25649160-25649182 CTGTGTAGGGGAGAAGAGGAGGG + Intergenic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1125788483 15:42343866-42343888 GTGTGGAAGGGAGAGCAGGAAGG + Intronic
1126725073 15:51623105-51623127 CTGCGGACTGGGGCGGAGGTGGG + Intergenic
1127033147 15:54886349-54886371 GTGAGGTCGGGGGAGGGGGAAGG + Intergenic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128320604 15:66691259-66691281 GTGGGGTCAGGGGAGGAGGAGGG + Intergenic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128452676 15:67815125-67815147 CACTGGGTGGGGGAGGAGGAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128997755 15:72309428-72309450 ATGTGGACCCGGGAAGAGGAGGG + Intronic
1129257519 15:74342492-74342514 GTCTGGAAAGGGGAGGAGGAAGG + Intronic
1129288770 15:74547160-74547182 GTGTCGGCGGGGGAGGGGGAAGG - Intronic
1129700176 15:77763304-77763326 CTGGGGCCTGGAGAGGAGGAGGG + Intronic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130146179 15:81275343-81275365 CAGTTGACGGGGGAGGAGGGGGG + Intronic
1130635969 15:85620283-85620305 CTGTGCACAGTGGAGGATGAGGG + Intronic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1130995128 15:88899288-88899310 CTGGGGACTGGGGAAGGGGAGGG - Exonic
1131090903 15:89624429-89624451 CTTTAGAAGGGGGTGGAGGAGGG - Exonic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132161027 15:99542881-99542903 CTGTGGAGAGGGGAGGAGTGGGG + Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132589296 16:719494-719516 GTGTGGACGGGAGAGGAGTGGGG + Exonic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132726852 16:1342654-1342676 CCAAGGACGGGGGTGGAGGACGG - Intronic
1132804155 16:1768046-1768068 CTGGGGACATGGGAGGAGCATGG - Intronic
1132829008 16:1918491-1918513 GAGTGGGCGGGGGAGGGGGAGGG - Intergenic
1132868177 16:2104056-2104078 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1132869218 16:2108205-2108227 GTGTGGACGGGTGAGGGGCATGG + Intronic
1132897215 16:2234790-2234812 CGGTGGAGGTGGGAGGGGGAGGG + Intronic
1133478426 16:6146178-6146200 CTGTGGGAGGGGGTGGAGGCAGG + Intronic
1133493066 16:6290382-6290404 TTTTGGACAGTGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133772574 16:8875899-8875921 CTGGGGACAGGTGAGGAGGTGGG + Intergenic
1133993371 16:10728059-10728081 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134036401 16:11034572-11034594 CCGTGGACAGGGGTGGAGGGCGG - Intronic
1134066606 16:11232481-11232503 AGGGGGAGGGGGGAGGAGGAGGG + Intergenic
1134066613 16:11232494-11232516 AGGAGGAGGGGGGAGGAGGAGGG + Intergenic
1134479283 16:14603540-14603562 ATGTGGGTGGTGGAGGAGGAAGG - Intronic
1134549300 16:15131868-15131890 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1134550271 16:15135602-15135624 GTGTGGACGGGTGAGGGGCATGG + Intronic
1134718197 16:16367393-16367415 GTGTGGACGGGTGAGGGGCAGGG - Intergenic
1134956555 16:18384766-18384788 GTGTGGACGGGTGAGGGGCAGGG + Intergenic
1135016107 16:18926196-18926218 CGGAGGGCGGGGGAAGAGGACGG + Exonic
1135250693 16:20899593-20899615 GTGTGCATGGGGGAGGATGAGGG + Intronic
1135806958 16:25551432-25551454 TGGTGGAGGGAGGAGGAGGATGG + Intergenic
1136093259 16:27935748-27935770 CTGAGGACCAGGGAGCAGGAGGG - Intronic
1136254815 16:29031007-29031029 CTATGGAAGGCCGAGGAGGATGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136358322 16:29761153-29761175 GCCTGGACTGGGGAGGAGGAGGG + Intergenic
1136383088 16:29905987-29906009 GGGTGGGCGGGGGCGGAGGATGG + Exonic
1136447886 16:30335169-30335191 CGGAGGGCGGGGGAAGAGGACGG + Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137343157 16:47630023-47630045 GTGGGGTCGGGGGAGGAGGGGGG + Intronic
1137832575 16:51558047-51558069 ATGGGGAGGGGGGAGGATGAGGG + Intergenic
1138096870 16:54218770-54218792 AGGTGGGCGGGGGAGGAGGCTGG + Intergenic
1138106045 16:54287486-54287508 CTGGGAATGGGGGAGGAGCAGGG + Intergenic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138299642 16:55915400-55915422 CAGTGGAAGGGGGTGGAGAAGGG + Intronic
1138350222 16:56342390-56342412 CTGTGGAGGGGGCAGCAGGGAGG - Intronic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139910602 16:70395176-70395198 CTGTGGAAGGGAGGGGAAGATGG + Intronic
1139924459 16:70478528-70478550 CTGCGGACGGGGCAGGAGAAGGG - Intronic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140396721 16:74633588-74633610 CTGGGGATGGGAGAGGAGGGAGG + Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141125098 16:81395505-81395527 CAGAGGACGGGAGAGGAGGGAGG - Intergenic
1141333204 16:83131187-83131209 CTGTGGGCGGGGGGGGGGGGGGG - Intronic
1141458241 16:84159126-84159148 CTTAGGACCAGGGAGGAGGAAGG - Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141631689 16:85291466-85291488 CGGGGGCCGGGGGAGGAGGCTGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142454436 16:90210476-90210498 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142682795 17:1560399-1560421 CGGGGGACGGGGGAGGAGCAGGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142759617 17:2035052-2035074 TTGGGGAAGGGGGTGGAGGAGGG + Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143500456 17:7335759-7335781 TTGAGGAGAGGGGAGGAGGAAGG + Intergenic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143749336 17:9016984-9017006 CTGAGGATGGGGGAGGAGCTGGG - Intergenic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144382988 17:14721191-14721213 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
1145031380 17:19507571-19507593 GTGGGGACGCGGGTGGAGGAGGG - Intronic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145836072 17:27955220-27955242 CTGTGGAACGGGGAGCAGCAGGG - Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146397674 17:32481654-32481676 CCCTGGAGGGGAGAGGAGGAAGG - Exonic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146926689 17:36750499-36750521 CTGAGGACGGGGCATGAGGCAGG - Intergenic
1147161116 17:38569859-38569881 CTGTGGCCTGGGGAAGGGGAGGG + Intronic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147738192 17:42654241-42654263 CTTTGGGCGGCGGAGGAGGGAGG + Intergenic
1148013351 17:44503450-44503472 CGGTGGGCGTGGGAGGAGGCGGG - Intergenic
1148171613 17:45525814-45525836 GAGTGGACGGGAGAGGAGAAAGG - Intergenic
1148562439 17:48613668-48613690 CCGCGGTCGGCGGAGGAGGAGGG + Intronic
1148585378 17:48774887-48774909 CTTTGGAAGGCTGAGGAGGATGG + Intronic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1149451209 17:56751375-56751397 GTGCGGACGGAGGAGGAAGAGGG + Intergenic
1149994430 17:61399422-61399444 CTCTGGGCGCGGGAGAAGGAGGG + Intergenic
1150130640 17:62666986-62667008 CTGGGGAGGGGGGTGGAGGTCGG - Intronic
1151166112 17:72205303-72205325 CTGTGGATGGATGAGGAGGGCGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151320897 17:73351852-73351874 GTGTGGCAGGGGGAGGAGGCTGG + Intronic
1151404407 17:73877453-73877475 CTGTGGATGGGAGGTGAGGAAGG - Intergenic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152380707 17:79941115-79941137 CAGAGGACGGGGGGTGAGGAGGG + Intronic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1152636593 17:81432830-81432852 CTGGGGATGGGGGGGGAGGGTGG - Intronic
1152636621 17:81432879-81432901 CTGGGGATGGGGGGGGAGGTTGG - Intronic
1152727842 17:81956447-81956469 CTGTGTACCAGGGAGGAGGCCGG - Intronic
1152727849 17:81956470-81956492 CTGTGTACCAGGGAGGAGGCCGG - Intronic
1152727856 17:81956493-81956515 CTGTGTACCAGGGAGGAGGCCGG - Intronic
1153013745 18:564943-564965 TTGTGTACGTGTGAGGAGGAGGG + Intergenic
1153471073 18:5445923-5445945 CTATGGACTGGGGTGGAGGATGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154193270 18:12247656-12247678 CTGAGGACGGGGCAGGAGAGGGG + Intergenic
1154341514 18:13506361-13506383 CTGGGGTGGGGGGAGGGGGAGGG - Intronic
1154370937 18:13762603-13762625 GTGTGGATGGGGGAGCAGGCTGG - Exonic
1154520903 18:15229251-15229273 GTGTGGTCGGGGGAGGGGGGAGG - Intergenic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1156036146 18:32770251-32770273 TTGTCGTCGGGGGAGGAAGAAGG + Exonic
1156170211 18:34474020-34474042 CTCTGGAAGGAGGAGGAGTAGGG - Intergenic
1156292405 18:35759456-35759478 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1156453325 18:37279028-37279050 GTGTGGATGGAGGAGGAGGGTGG - Intronic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157126458 18:44960815-44960837 GGGTGGAGGGTGGAGGAGGAAGG - Intronic
1157257261 18:46150379-46150401 ATGTGGAGGTGGGAGGAGGCTGG - Intergenic
1158913636 18:62096673-62096695 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159134138 18:64317194-64317216 CTGTTGTCAGGGGAGGGGGAGGG - Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160583014 18:79898428-79898450 GTGGGGACTGGGCAGGAGGAGGG + Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161396682 19:4048245-4048267 CTGTGGACGGGGCACGGGGCGGG + Intronic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161480657 19:4508733-4508755 CTGGGGACGGGGCAGCAGCAGGG + Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
1162954608 19:14091043-14091065 CGGCGGGCGGGGGAGGGGGAGGG + Intergenic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163085943 19:14979782-14979804 CTGGGCGCGGGGGAGGCGGAGGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163164920 19:15489546-15489568 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163633360 19:18427840-18427862 CTGTGGAAGGGGGTTGAGGGAGG + Intronic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1163789462 19:19297965-19297987 CTGTGGACTGGGGATGTGTACGG - Intronic
1163849808 19:19656510-19656532 CTGTGGACTGGGGAGCCGGGTGG - Intronic
1164402343 19:27910822-27910844 CTGGGGCCGGGGGAGGAGGGTGG + Intergenic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1165059124 19:33196124-33196146 CTTGGCACGGGGGAAGAGGATGG + Intronic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165394675 19:35557873-35557895 CTGTGGACGGGGGAACGGGGCGG + Intronic
1165433037 19:35783124-35783146 CTGAGGAGGAGAGAGGAGGAGGG + Intronic
1165490694 19:36121226-36121248 CGGAGGAGGGCGGAGGAGGAAGG + Intronic
1165605906 19:37104129-37104151 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1165772993 19:38389180-38389202 CTGTTGTCGGGGGAGGCGGGCGG + Intronic
1165799353 19:38538040-38538062 CATTGACCGGGGGAGGAGGAGGG - Intronic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166026685 19:40092086-40092108 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1166046579 19:40233952-40233974 CTGTGGGCGGCAGAGGTGGATGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166361269 19:42253925-42253947 GCGGGGACGGGGGAGGGGGAAGG - Intronic
1166361758 19:42255437-42255459 CAGTGGGCAGGAGAGGAGGAGGG - Intergenic
1166888105 19:45973563-45973585 CGGGGGGCGGGGGAGGGGGAGGG + Intergenic
1166894315 19:46014670-46014692 CTGGCGAGGTGGGAGGAGGAGGG + Intronic
1167153587 19:47724439-47724461 CAGTGGATGGGGGCAGAGGAGGG + Intronic
1167268273 19:48493953-48493975 CCGGGGCCGGCGGAGGAGGACGG - Exonic
1167460071 19:49620483-49620505 CTGAGGCCTGGGGAGGAGGGGGG + Intronic
1167611208 19:50508496-50508518 CTGGGGACAGGGGACCAGGAAGG - Intronic
1167645485 19:50703123-50703145 CTCTGGAGGGAGGATGAGGAAGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168072002 19:53958581-53958603 CTGGGGACGCGGGAGGGGGCGGG + Intergenic
1168257292 19:55173809-55173831 CTCGGGACGGGGGAGGGGGTGGG + Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168354171 19:55691789-55691811 CTGTGGTCGGGGCAGGAGCTGGG - Exonic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168468810 19:56624897-56624919 CTCTGGATGGGAGAGGGGGATGG - Exonic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
924985099 2:263906-263928 CGGTGGTGGGAGGAGGAGGACGG - Intronic
925001898 2:409886-409908 GTGTGGATGGGGGAGGATGGTGG - Intergenic
925058389 2:872519-872541 ATGGGGTCCGGGGAGGAGGATGG - Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
926104907 2:10143985-10144007 GTGGAGACGGGAGAGGAGGAAGG - Intronic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926687987 2:15712929-15712951 CAGTGGGCAGGGGAGAAGGAAGG - Intronic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928103289 2:28452039-28452061 CTGTGGCCGTGGGAGCAGGCGGG + Intergenic
928285578 2:29987406-29987428 CTGGGGAGAGGAGAGGAGGAAGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928408894 2:31038552-31038574 CGTTGGCCGGGGGAGGGGGAGGG + Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
930569781 2:53070709-53070731 GTGGGGTAGGGGGAGGAGGAAGG + Intergenic
930751295 2:54937034-54937056 CTGTGGGAGGCGGAGGAGGGTGG + Intronic
932010455 2:67972469-67972491 TTGAGGGCGGTGGAGGAGGAGGG - Intergenic
932140566 2:69273670-69273692 GTGTGGGTGGGGGAGGAGGTGGG - Intergenic
932274448 2:70441659-70441681 CTGTGGTGGGGGGGGGAGGGGGG - Intergenic
932770665 2:74499210-74499232 CTGAGGACAGGGGAGGATTAGGG + Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933529614 2:83490082-83490104 CTGGGGTTGGGGGAGGGGGAGGG + Intergenic
933778943 2:85788211-85788233 GTGTGGAAGGGGGTGGAGGGCGG + Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
935191466 2:100781927-100781949 CTGGGGACTGGGGAGGGAGAAGG - Intergenic
935197827 2:100830463-100830485 GTGGGGTCGGGGGAGGGGGAGGG - Intronic
935205779 2:100895607-100895629 GTGTGGAGGGGCGGGGAGGAGGG - Intronic
935268812 2:101416190-101416212 CTGGGGAGGGGGGTGGAAGAAGG + Intronic
935402422 2:102674348-102674370 CTCTGGACAGGGGAGGACAATGG + Intronic
935838367 2:107079750-107079772 CTATGGACGGGGGAGGTGAGAGG + Intergenic
935986425 2:108677678-108677700 CTATAGACGGGAGAGGAGGTGGG - Intronic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936138872 2:109921339-109921361 CTATAGACGGGAGAGGAGGTGGG - Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936205824 2:110450146-110450168 CTATAGACGGGAGAGGAGGTGGG + Intronic
936428406 2:112437529-112437551 CCGTGGGCGGGGGAGGAGCCTGG - Intergenic
936851945 2:116910122-116910144 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937093847 2:119223614-119223636 CTGGGGCCAGGGGAGGAGGGTGG + Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937207612 2:120246528-120246550 GTTAGGAAGGGGGAGGAGGAAGG - Intronic
937373078 2:121315893-121315915 CTTTGGGAGGGTGAGGAGGATGG + Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938301505 2:130217524-130217546 CGGGGGACGGGGGCGGAGGGGGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939294165 2:140237166-140237188 GGGTGGAGAGGGGAGGAGGAAGG - Intronic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940457816 2:153923682-153923704 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
940752772 2:157645928-157645950 GTGTGGTCGGGGGAGGGGGGAGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
940993382 2:160120516-160120538 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
943426792 2:187747886-187747908 CTGGGGTCGGGGGAGCAGGGAGG + Intergenic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
944249534 2:197567372-197567394 CTTTGGAAGGCTGAGGAGGAAGG - Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944641259 2:201728237-201728259 GTGGGGTCGGGGGAGGAGGGAGG - Intronic
944822046 2:203441026-203441048 CTGGGGTTGGGGGTGGAGGAGGG + Exonic
945942479 2:215963214-215963236 CTGTGGAAGGCCGAGGCGGATGG + Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
946603481 2:221376543-221376565 CTCTGGACTGGGGAGGAGAAGGG - Intergenic
946921496 2:224585414-224585436 GGGTGGAGGGGGGAGGAGGGAGG + Intergenic
947395613 2:229683930-229683952 CTCTGCACAGGAGAGGAGGAAGG - Intronic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948538964 2:238672210-238672232 AGGAGGAGGGGGGAGGAGGAGGG - Intergenic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
948768026 2:240233441-240233463 CTGTGGGCGGGGCCGGAGAAGGG - Intergenic
948768102 2:240233662-240233684 CTGTGGGCGGGGTCAGAGGAGGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948790175 2:240372772-240372794 CTGTGGTGGGGGGAGGGGCATGG + Intergenic
948796674 2:240406494-240406516 TTTTGGAGGGGGCAGGAGGAAGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948835733 2:240625164-240625186 AAGTGGGCTGGGGAGGAGGAAGG + Intronic
949085894 2:242155131-242155153 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1168956958 20:1841155-1841177 CTTGGGTCGGGGGAGCAGGATGG - Intergenic
1169132955 20:3176495-3176517 CTTTGGAAGGTGGAGGAGGGTGG - Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169383086 20:5125988-5126010 CTTTGGAAGGCGGAGGCGGACGG + Intronic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171370697 20:24660519-24660541 CTGACGAGTGGGGAGGAGGAGGG - Intronic
1171406397 20:24914923-24914945 CTGAGGACAGGGGAGGCGCAGGG - Intergenic
1171434775 20:25112813-25112835 CTGTTGTCGGGGGAGGGGGGAGG + Intergenic
1171802856 20:29642496-29642518 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1171865211 20:30484321-30484343 GTGTGGGTGGGCGAGGAGGACGG + Intergenic
1171969971 20:31558292-31558314 GGCTGGAGGGGGGAGGAGGAGGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172903344 20:38350727-38350749 CTGTGGAGAGGGGAGGCGCAAGG + Intronic
1173257303 20:41403826-41403848 CTGTCGACGGGGGTGGGGCAAGG - Exonic
1173335820 20:42111852-42111874 CAGTTGACGGGAGAAGAGGAAGG + Intronic
1173523703 20:43716747-43716769 CTGGGGGCGGAGGAGGACGATGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173577771 20:44124054-44124076 CTGGGGCCGGGGGAGGAACAGGG + Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1174125126 20:48298748-48298770 TTATGGACTGTGGAGGAGGATGG + Intergenic
1174658788 20:52192699-52192721 GAGTGGTTGGGGGAGGAGGAGGG - Intronic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1175208126 20:57327625-57327647 CTTTGGGAGGGTGAGGAGGATGG + Intergenic
1175310590 20:58009013-58009035 TTCAGGACAGGGGAGGAGGAGGG + Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175550784 20:59815955-59815977 CCATGGACCAGGGAGGAGGATGG + Intronic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175962067 20:62642354-62642376 CTGTGCCCTGGGGGGGAGGAGGG + Exonic
1175992196 20:62795219-62795241 CCGGGGACGGGGGAGGGGGAGGG - Intergenic
1176034881 20:63031379-63031401 CTGGGGCTGGGGGAGGAGGGAGG + Intergenic
1176130155 20:63493426-63493448 CTATGGGCTGGGGAGGAGCAGGG - Intronic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1177351345 21:19946049-19946071 CTGGGGTCGGGGGAGGGGGGAGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178580070 21:33831136-33831158 CTTTGGATGGGGGAGGATGCGGG - Intronic
1178690588 21:34746587-34746609 CTCTGGCTGGGGGAGGAGGGTGG + Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179826524 21:43969097-43969119 CTCTGGAGGGAGGAGAAGGAGGG - Exonic
1179880844 21:44292773-44292795 GTGTAGACGGGGGAGGAGGGAGG + Intronic
1180311943 22:11249205-11249227 GGGTGGGCGGGCGAGGAGGATGG + Intergenic
1180960543 22:19760600-19760622 CTGGGGGCCGGGGAGGGGGAAGG + Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181149437 22:20872641-20872663 CTTTGGAAGGCGGAGGCGGATGG - Intronic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181637498 22:24181254-24181276 CTGTGGGAGGGTGAGGAGGCCGG - Exonic
1181934258 22:26428136-26428158 CTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181985489 22:26797404-26797426 GTGTGGACGTGAGTGGAGGAGGG - Intergenic
1182026156 22:27120894-27120916 CTGGGGCCTGGGGAGCAGGAGGG - Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182260719 22:29071697-29071719 GGGAGGGCGGGGGAGGAGGACGG + Intergenic
1182624892 22:31638415-31638437 CTGTGGAGGGGCGAGGAAGGGGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182790298 22:32946541-32946563 GTGGGGCCGGGGGAGGGGGAGGG + Intronic
1182810069 22:33108533-33108555 CTGTGCACGGTGGGGCAGGAAGG + Intergenic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183264317 22:36816256-36816278 TGGAGGACAGGGGAGGAGGAAGG + Intronic
1183311150 22:37110047-37110069 CTGGGGACTGGAGAGGAGAAAGG + Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183815146 22:40293607-40293629 CTGAGGGCGGGGGCGGAGGGGGG + Intronic
1183914853 22:41109719-41109741 TTTTGGCAGGGGGAGGAGGACGG + Intronic
1184096652 22:42319779-42319801 CGGTGGACAGGCGAGGAGGCCGG + Intronic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184698100 22:46150737-46150759 CGGCGGACGGGGGAGGGGCAGGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185135630 22:49070447-49070469 CTGTGGTGGGGAGAGGAGGCTGG + Intergenic
1185377040 22:50487486-50487508 GTGTGGATGGGGGAGAAGGGGGG - Intronic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950129708 3:10533797-10533819 GTGTAGACTGTGGAGGAGGAAGG - Intronic
950181363 3:10915679-10915701 CTGAGGACTGGAGGGGAGGAGGG + Intronic
950589726 3:13928412-13928434 TTGTGGAGGGCGGAGGAGGATGG - Intergenic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
950710567 3:14810619-14810641 CGCGGGGCGGGGGAGGAGGAGGG - Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951459960 3:22940808-22940830 CCATGGACTGGGGAGGGGGATGG - Intergenic
951523452 3:23630611-23630633 CTTTGGAAGGCGGAGGAGGGCGG + Intergenic
951830160 3:26917610-26917632 CTGTTGTCGGGTGGGGAGGAGGG - Intergenic
952890555 3:38037447-38037469 CTATGGTGGGGGGAGGAGGAGGG - Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953301344 3:41779834-41779856 GTGTGGTCGGGGGAGGGGGGAGG + Intronic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
954326168 3:49865341-49865363 CCGTGTACTGGGCAGGAGGATGG + Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954432444 3:50478125-50478147 CTGTGGTGGGGAGCGGAGGAGGG - Intronic
954529677 3:51308145-51308167 CTGTGGAGGTGGGAGGGGAAGGG + Intronic
954753980 3:52829084-52829106 GTGTGGAGAGGGGAGGAGGGTGG + Intronic
955060295 3:55487465-55487487 CTGTGGCCCGGGGCGGGGGAAGG + Exonic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955331333 3:58049933-58049955 CCGTGGATGGGGGCAGAGGAGGG + Intronic
955589160 3:60515323-60515345 ATGTGGTGGGAGGAGGAGGAAGG + Intronic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
958196618 3:90248915-90248937 CTTTGGAAGGCTGAGGAGGATGG - Intergenic
958574454 3:95929764-95929786 CTATGGGCCGGGGAAGAGGAGGG + Intergenic
958924565 3:100144137-100144159 CTCTGTGCGGGGGAGGAGTAGGG + Intronic
958937016 3:100266510-100266532 CTGTGGTAGGGTGAGGAGGGTGG - Intronic
959370229 3:105514731-105514753 AAGTGGTGGGGGGAGGAGGAAGG + Intronic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962821459 3:139051614-139051636 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
963106426 3:141651270-141651292 CTGGGAACTGGGGAGGATGAAGG + Intergenic
963525623 3:146411029-146411051 GTGTGGATGGGGGAGGACAAGGG - Intronic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
963606226 3:147413477-147413499 TGGTGGACTGCGGAGGAGGAGGG - Exonic
963614330 3:147516581-147516603 CTTTGGAAGGCGGAGGCGGACGG - Intergenic
964530508 3:157662918-157662940 GTGGGGTCGGGGGAGGAGGGAGG - Intronic
964671345 3:159229718-159229740 GGGAGGATGGGGGAGGAGGAGGG - Intronic
964842551 3:161010144-161010166 ATGGGGTGGGGGGAGGAGGAGGG - Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965724589 3:171700714-171700736 TTCTGGACAGGGGAGAAGGAAGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967385346 3:188905561-188905583 CTTTGGGAGGTGGAGGAGGATGG - Intergenic
967597870 3:191349078-191349100 CTGCTGATGGGGGTGGAGGAGGG + Intronic
967943034 3:194780827-194780849 CAGAGGACGGGGGAGGTTGAGGG + Intergenic
968477711 4:820263-820285 CTCTGGACCTGGGAGGACGATGG - Intronic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968590916 4:1459234-1459256 TGGTGGAGAGGGGAGGAGGATGG + Intergenic
968701688 4:2060619-2060641 GGGGGGAGGGGGGAGGAGGAAGG - Intronic
968933548 4:3597365-3597387 CTGTGGACGCTGGAGCAGAAGGG + Intergenic
968982101 4:3855830-3855852 CGGTGGACGGGAGTGGAGGTGGG - Intergenic
968985374 4:3871862-3871884 CGGTGGAGGGGTGAGGGGGAGGG + Intergenic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969549261 4:7853504-7853526 ATGAGGACTGGGGAAGAGGAGGG - Intronic
970161632 4:13194944-13194966 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
970341542 4:15112674-15112696 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
970608579 4:17705238-17705260 CTGGGGAGGGGTGAGGAGCAAGG + Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
974177192 4:58339314-58339336 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
974314504 4:60260936-60260958 CTGTGGGCCGGTGAGGAGGAGGG - Intergenic
974382180 4:61155139-61155161 CTGGGGGCAGGAGAGGAGGAGGG - Intergenic
974671014 4:65030085-65030107 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
975199770 4:71573518-71573540 GTGGGGTCGGGGGAGGGGGAGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976251791 4:83059942-83059964 CTTTGGAAGGCGGAGGAGGGCGG - Intronic
976349047 4:84039863-84039885 CTATTGACTGGGGAGGAAGAGGG + Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976853647 4:89577772-89577794 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
979237600 4:118420030-118420052 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
979948255 4:126860995-126861017 CTGTGGTGGGGGGAGGGGGGAGG - Intergenic
980624593 4:135357968-135357990 CTTTGGGAGGGCGAGGAGGATGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981718442 4:147775272-147775294 CTGGGGACTGGCCAGGAGGAGGG - Intronic
982000060 4:151014577-151014599 GTGATGACGGGGGAGGTGGAGGG - Exonic
982067667 4:151668797-151668819 CTGTTGCCTGGGGAGGAGGTTGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984715283 4:182918832-182918854 CGGTGGATTTGGGAGGAGGAGGG - Intergenic
985017569 4:185652394-185652416 CTGTGGACAGGGGAGGATGGAGG + Intronic
985576294 5:674983-675005 CTGTGGCCGGGGGAGCAGTGAGG + Intronic
985628318 5:1001632-1001654 CCATGGACGGGGCAGGAGGCAGG + Intergenic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985955554 5:3263028-3263050 GTGTGGACTTGGGAGGAGGGTGG + Intergenic
986178797 5:5374323-5374345 CTGTGGATGTGAGAGGAGAAAGG + Intergenic
986748091 5:10761379-10761401 CTGTGGCCGGGGGCGGGGGCGGG + Intergenic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
987233880 5:15923847-15923869 CTGTGCATGGGGGCGGAGGGGGG - Intronic
988224079 5:28389700-28389722 GTGGAGTCGGGGGAGGAGGACGG - Intergenic
989810276 5:45664307-45664329 GTGGGGTCGGGGGAGGGGGAGGG + Intronic
990036735 5:51330927-51330949 CTGTGGTGGGGGGAGGAGGGGGG - Intergenic
991115532 5:62950444-62950466 ATGGGGAGGGGGGAGGAGGGAGG - Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
992002783 5:72451907-72451929 CTCTGGACCAGGGAGGAGAAGGG - Intronic
992007844 5:72495894-72495916 CTTTGGACAGGGGAGTAGGATGG - Intronic
992181994 5:74206596-74206618 CTGTGAACAGAGGAGGAGGGAGG - Intergenic
992342654 5:75841360-75841382 ATGGGGTCGGGGGAGGGGGAAGG - Intergenic
992448654 5:76856051-76856073 ATGTGGCCGGAGGAGGAGGAAGG - Intronic
992487385 5:77210246-77210268 CTCTGGACAGCGGAGGAGGAGGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993448112 5:88039735-88039757 CTGTGGAAGGCCGAGGAGGGCGG + Intergenic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
994671443 5:102766163-102766185 CCATGGACTGGGGTGGAGGAAGG + Intronic
995011902 5:107265686-107265708 TTGGGGATGGGTGAGGAGGAGGG - Intergenic
996003920 5:118398345-118398367 CGGGGGAGGGGGGAGGAGGGAGG - Intergenic
996147912 5:119997846-119997868 TTGTGGGCGGGGGAGGGGGGAGG - Intergenic
996880718 5:128293979-128294001 GTGGGGTCGGGGGAGGAGGGAGG - Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
997600748 5:135136797-135136819 TTGTGGGCGGGGGAGGGGGGAGG - Intronic
997681804 5:135761755-135761777 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
997760812 5:136445961-136445983 GTGTGTTCGGGAGAGGAGGAAGG - Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
997932590 5:138084429-138084451 CTGTGGTTGGGGGAGCAGGCAGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998565812 5:143214967-143214989 CTGTGGACAGGAGAGGTGGCTGG - Intronic
998757265 5:145394432-145394454 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999467608 5:151822461-151822483 CTGTGGGCGGGGGGTCAGGAGGG - Intergenic
999784908 5:154882255-154882277 CAGTGGAAGGGGGAAGATGAGGG - Intergenic
1000064555 5:157683532-157683554 GTGAGGAGGGGAGAGGAGGAGGG - Intergenic
1000194265 5:158942841-158942863 ATGTGGTCGAAGGAGGAGGAGGG + Intronic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001404955 5:171469732-171469754 CAAGGGAGGGGGGAGGAGGAGGG - Intergenic
1001416357 5:171547033-171547055 CTGTCGGCGGGTGAGGAGCAAGG - Intergenic
1001818270 5:174689694-174689716 CTTTGGAAGGCGGAGGAGGGTGG + Intergenic
1001855070 5:175003830-175003852 CTGTGGAAGGGAGAGGAGACTGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002103144 5:176867242-176867264 CTACAGACGGGGCAGGAGGAGGG + Intronic
1002194528 5:177494882-177494904 CTGGGGTCAGGGGAGGGGGAGGG + Intronic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002429364 5:179194163-179194185 CTGCGGAGGAGGGAGGAGGGAGG + Intronic
1002606060 5:180383444-180383466 CTGAGTACGGTGGAGCAGGAAGG - Intergenic
1002738031 5:181411995-181412017 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003134950 6:3427898-3427920 CTCTGGTCGGGAGAGGAAGAAGG + Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003612593 6:7627099-7627121 CTGTGGTCTGGTCAGGAGGAAGG - Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1004715524 6:18213191-18213213 CTTTGGAAGGCTGAGGAGGATGG + Intronic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005041765 6:21606748-21606770 TTGTGGATGGTAGAGGAGGAAGG - Intergenic
1005551177 6:26918317-26918339 ATGGGGTCGGGGGAGGGGGAAGG - Intergenic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1005886409 6:30101050-30101072 CTGGGGACTGGGTAGGCGGATGG - Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005957798 6:30676784-30676806 CTGTGGTCAAGGGAGGAGGCAGG + Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006088997 6:31616694-31616716 GGGTGGAAGGGGGAAGAGGAAGG - Intronic
1006174332 6:32112817-32112839 ATGTGGACGAGGGAGCAGAATGG + Intronic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006242037 6:32691124-32691146 GTGGGGAGGGGGGAGGAGGGAGG - Intergenic
1006369288 6:33634100-33634122 CTGGCGACAGGGGAGCAGGAGGG - Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006778671 6:36616929-36616951 CTGAGGCCCAGGGAGGAGGAGGG + Intergenic
1006820047 6:36885962-36885984 CTGCCGCCGGGCGAGGAGGATGG - Exonic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1006949524 6:37809852-37809874 CTGGGGTGGGGGGAGGAGGGAGG + Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984094 6:38166337-38166359 GTGCGGAGGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007321246 6:41030346-41030368 CTGTGGATGGTAGAGGAGGGTGG - Intronic
1007390173 6:41546326-41546348 GAGGGGGCGGGGGAGGAGGAGGG - Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007751301 6:44073524-44073546 GGGTGGGAGGGGGAGGAGGAGGG + Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1008012986 6:46488939-46488961 CTGTGGAGGTGTGAGGAGGTGGG - Intronic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1008404558 6:51104164-51104186 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1008451488 6:51656335-51656357 CTGTTGACGGGTGGGGAGCAAGG + Intronic
1008548823 6:52607728-52607750 CTGCTGTCGGGGGCGGAGGAAGG - Intergenic
1008624920 6:53306189-53306211 CCGTGGAAAGGGGAGGAGAAAGG + Intronic
1008626069 6:53317643-53317665 GTGGGGTCGGGGGAGGAGGGAGG + Intronic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1008967496 6:57327864-57327886 CTGAGGTCGGGGGATGGGGAGGG + Intronic
1009188898 6:60605808-60605830 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
1009534960 6:64870409-64870431 TTTTGGAGGGGGGAGGAGGGGGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1011427009 6:87240369-87240391 CGGTGGGTGGGGGAGGGGGAGGG + Intronic
1012631274 6:101470617-101470639 CTGGGGATGGGGGAAGAGTAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013924098 6:115447191-115447213 GTGGGGTGGGGGGAGGAGGAAGG + Intergenic
1013988548 6:116225928-116225950 CTTTGGAGGGGGGTGGAGGCTGG + Intronic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1014397089 6:120937470-120937492 ATGGGGTCGGGGGAGGAGGGAGG + Intergenic
1014606352 6:123477908-123477930 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1015774075 6:136795908-136795930 CTGCGGACGGGAGGGAAGGAGGG - Intergenic
1015861250 6:137682658-137682680 ATGGGGTCGGGGGAGGGGGAAGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017010619 6:150060889-150060911 ATGTGGACGGTGGAAAAGGAGGG + Intergenic
1017861153 6:158398403-158398425 CAGTGGGTGGGTGAGGAGGAGGG - Intronic
1018020822 6:159761411-159761433 CTGTGAACGGGTGAGGACGCCGG - Exonic
1018021216 6:159763307-159763329 CTTTGGGAGGCGGAGGAGGAAGG + Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018767433 6:166945135-166945157 GTGTGGACGTGGGTGGATGAGGG - Intronic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1018865998 6:167747628-167747650 CTGTGGAAGGGAGGGGGGGAGGG + Intergenic
1018985883 6:168636915-168636937 GTGGGGAGGGGGGAGGAGGGAGG - Intronic
1019101381 6:169633270-169633292 AGGTGGACGGGGGTGGGGGAGGG + Intronic
1019170526 6:170130963-170130985 ATGTGGCCTGGGGATGAGGAGGG - Intergenic
1019243132 6:170687554-170687576 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1019283250 7:211122-211144 AGGCTGACGGGGGAGGAGGAAGG - Intronic
1019320651 7:414073-414095 GGGAGGAGGGGGGAGGAGGAGGG - Intergenic
1019345392 7:527177-527199 GGGTGGGAGGGGGAGGAGGAAGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019417045 7:932569-932591 CTGTTGTCCGGGGAGGGGGATGG + Intronic
1019436972 7:1027576-1027598 CTGAGGACGGCGGAGCAGGCCGG - Intronic
1019713056 7:2526089-2526111 CTGTGGCCAGGGGAGGCAGAGGG + Intronic
1020080247 7:5282866-5282888 AGGAGGAGGGGGGAGGAGGAGGG + Intronic
1021435251 7:20606317-20606339 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021534824 7:21691349-21691371 CTGGGGTGGGGGGAGCAGGAGGG + Intronic
1021943798 7:25705290-25705312 GTGGGGATGGGGGAGAAGGAGGG + Intergenic
1021993935 7:26161756-26161778 CTCTGGATGGGGGTGGAGGTAGG + Intronic
1021994186 7:26163798-26163820 GTGGGGTCGGGGGAGGAGGGAGG - Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023875226 7:44283081-44283103 CTGTGGAGGTGGGTGCAGGAAGG - Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024721006 7:52137373-52137395 AGGAGGAGGGGGGAGGAGGATGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026656798 7:72263657-72263679 CTGTGGGAGGCGGAGGAGGGAGG - Intronic
1026827795 7:73595200-73595222 CCGTGGAGGGGCAAGGAGGAGGG - Intronic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1028064742 7:86369287-86369309 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
1029138563 7:98393283-98393305 CTGTGGGAGGCCGAGGAGGATGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029490983 7:100869794-100869816 CCATGGACTGGGGAGGGGGATGG + Intronic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1029538062 7:101167275-101167297 ATGGGGGCAGGGGAGGAGGAAGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030543154 7:110858745-110858767 GTGGGGTCGGGGGAGGAGGGAGG - Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031527626 7:122840278-122840300 GTGGGGTGGGGGGAGGAGGAAGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032083695 7:128872820-128872842 CTGGTGATGGGGGAGGAGGGAGG - Intronic
1032238130 7:130141698-130141720 CAGTGGGCGGGGGAGCAGGGAGG - Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033059318 7:138090391-138090413 CTTTGGAAGGCAGAGGAGGAAGG + Intronic
1033435940 7:141333746-141333768 CCGTGGACTGGGGTGGAGGGCGG + Intronic
1033890428 7:146006394-146006416 GGGAGGATGGGGGAGGAGGAGGG - Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034263836 7:149772347-149772369 CTGGGGACTGGGGACGGGGAGGG - Intronic
1034447750 7:151122181-151122203 CTTTGGCCCAGGGAGGAGGAAGG - Intronic
1034977906 7:155458643-155458665 GTGCGGGCGCGGGAGGAGGAAGG + Exonic
1035047215 7:155975557-155975579 CTGAGGAGGGGTGAGGAGGTGGG + Intergenic
1035133310 7:156675680-156675702 CTGTGAACTGAGGAGGAGGCGGG - Exonic
1035241891 7:157537705-157537727 CTGGGGATGGTGGAGGATGAGGG - Intergenic
1035284176 7:157795741-157795763 CTGTGGACGAGGCGGGAGGCGGG + Intronic
1035416888 7:158696726-158696748 GTGTGGACTTAGGAGGAGGAGGG - Intronic
1035504990 8:120609-120631 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036239967 8:7073309-7073331 ATGGGGGCGGTGGAGGAGGAGGG - Intergenic
1036565446 8:9934202-9934224 CTTTGGAAGGCGGAGGCGGAAGG + Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1037241892 8:16786683-16786705 CCGTGGACAGGGGATGGGGATGG - Intergenic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1037694908 8:21215081-21215103 ATGTGGAGGGGGGAGGACAAGGG + Intergenic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037952431 8:23027911-23027933 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1037963654 8:23117476-23117498 CTGAGGAAGGGGGATGAGAAGGG - Intergenic
1037967399 8:23145246-23145268 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038433194 8:27516127-27516149 CTGTGGACGGTGGTGGGGCACGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038930543 8:32188810-32188832 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1039002445 8:32996185-32996207 CTGTGCCCTGGGGAAGAGGAAGG - Intergenic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1039317410 8:36388716-36388738 GTGGGGACGGGGGAGGGGGGAGG - Intergenic
1039470947 8:37813636-37813658 CTATGGAGTGGGGAGAAGGAAGG + Intronic
1039822285 8:41144898-41144920 CACTGGACAGGGGAGGAGCAAGG - Intergenic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1040918033 8:52584057-52584079 CTTTGGGAGGGGGAGGAGGGAGG - Intergenic
1041120124 8:54578090-54578112 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041646674 8:60260203-60260225 CTGCGGTCTGGGGAGGAGGGAGG - Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042716082 8:71774161-71774183 CAGTGGACTGGGGTGGATGAAGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043128021 8:76425302-76425324 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043725080 8:83601315-83601337 GTGTGGTCGGGGGAGGGTGAAGG + Intergenic
1044578678 8:93800152-93800174 CTTTGGGAGGGTGAGGAGGATGG - Intronic
1044656506 8:94553782-94553804 CGGTGGATGGAGGAGGGGGAGGG + Intergenic
1045071620 8:98512113-98512135 GTGTGGTGGGGGGAGGAGGGAGG - Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1046434437 8:114168602-114168624 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1047006085 8:120621864-120621886 CTGGGGATCGGGGAGGAGGGAGG - Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047621006 8:126608002-126608024 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048600711 8:135916284-135916306 CGGGGGGCGGGGGAGGGGGAGGG - Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049157602 8:141076373-141076395 CAATGGGAGGGGGAGGAGGAAGG + Intergenic
1049479968 8:142817942-142817964 CGGTGGACCAGGCAGGAGGAGGG + Intergenic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1049747467 8:144269083-144269105 CCGTGGTGGTGGGAGGAGGATGG - Intronic
1050090855 9:2015896-2015918 TGGGGGACAGGGGAGGAGGATGG + Intronic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050290469 9:4148875-4148897 CTGTGGAGGAGAGAGGAGAATGG - Intronic
1050509801 9:6382274-6382296 GTGGGGTCGGGGGAGGAGGGAGG + Intergenic
1050659594 9:7868399-7868421 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1051328737 9:16000901-16000923 CCTTTGATGGGGGAGGAGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051534789 9:18144447-18144469 CTTTGGAAGGGCGAGGAGGGAGG - Intergenic
1051828297 9:21246899-21246921 TTGTGGGCGGGGGAGGGGGGAGG - Intergenic
1052312725 9:27085623-27085645 CTGTGGTAGGGAGTGGAGGAAGG + Intergenic
1052783174 9:32801913-32801935 CCATGGATGGGGGAGGAGGTGGG + Intergenic
1053001534 9:34579393-34579415 CTGGGGTTGGGGGAGAAGGAGGG + Intronic
1053159007 9:35800645-35800667 CTGGGGTCTGGGGAGGAGGCTGG + Intronic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054456596 9:65434452-65434474 CTGTGGACGCTGGAGCAGAAGGG - Intergenic
1055114030 9:72588030-72588052 CTTTGGAAGGCTGAGGAGGATGG - Intronic
1055931618 9:81565129-81565151 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056381714 9:86062474-86062496 GGGAGGACGGGGGAGGAGGGAGG + Intronic
1057302581 9:93895397-93895419 CTGTGGATTGGGGTAGAGGATGG - Intergenic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058656713 9:107228928-107228950 CGGGGGATGGGGGAGGAAGAGGG + Intergenic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1059296555 9:113275864-113275886 CGGTGGAGGGCTGAGGAGGAAGG + Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061751947 9:132784629-132784651 CTGAGGGCGGGGGAGGAGCTTGG + Intronic
1061806250 9:133139290-133139312 CTGCGGAGAGGGGAGGAGGCAGG + Intronic
1061917063 9:133760791-133760813 CTGAGGACGGAGGATCAGGAAGG + Intergenic
1061917084 9:133760884-133760906 CTGAGGACGAGGGATCAGGAAGG + Intergenic
1061917091 9:133760915-133760937 CTGAGGACGGCGGATCAGGAAGG + Intergenic
1062006374 9:134240336-134240358 GTGTGGCCGGGGGAGGAGGCGGG + Intergenic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1062469715 9:136697032-136697054 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062469726 9:136697051-136697073 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062733374 9:138121286-138121308 CTGTGTGCGGGGGAGGGCGATGG - Intronic
1203603321 Un_KI270748v1:36778-36800 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185860416 X:3573499-3573521 CTGGGGAAGGGAGAGGAGGCAGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186912367 X:14182314-14182336 CTGTGGATAGTGGAGGAGGGAGG - Intergenic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1187124363 X:16440011-16440033 CTGTTGGCGGGGGCGGGGGAGGG - Intergenic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1188256104 X:27963690-27963712 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1188621835 X:32235031-32235053 CCGTGGACCGGGTTGGAGGATGG + Intronic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1188935455 X:36170439-36170461 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1189146550 X:38661054-38661076 CTCTGGACAGGTGAGAAGGATGG + Intronic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189471477 X:41317827-41317849 TTAGGGATGGGGGAGGAGGAGGG - Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190205115 X:48396464-48396486 CGGGGGAGGGGGGAGGGGGAGGG - Intergenic
1190332280 X:49243199-49243221 GTGGGGAGGGGTGAGGAGGAAGG + Intronic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1191707956 X:64114326-64114348 GTGGGGTCGGGGGAGGAGGGAGG - Intergenic
1191727487 X:64296722-64296744 TTGGGGGCGGGGGAGGGGGAAGG - Intronic
1192112315 X:68377572-68377594 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
1192188799 X:68978293-68978315 CGGTGGACGGGGGTGGGGGAGGG - Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1193017334 X:76750110-76750132 CTGTGGACGGGGTGGCAGGTGGG - Intergenic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1193755979 X:85408950-85408972 CAGTGGACTGGGTAGGGGGAGGG - Intergenic
1193918150 X:87392642-87392664 CTGTGGAGGGGGGAAGAGTAAGG + Intergenic
1194094540 X:89620902-89620924 GTGGGGGCGGGGGAGGGGGAAGG + Intergenic
1195169520 X:102252278-102252300 CAGTGGCCGGGGGAGGGGGGTGG - Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195189337 X:102434821-102434843 CAGTGGCCGGGGGAGGGGGGTGG + Intronic
1195315565 X:103674534-103674556 GTGGGGAGGGGGGTGGAGGAGGG - Intergenic
1195485248 X:105397277-105397299 CTATGGACTGGGGAGGTGGCAGG - Intronic
1195520317 X:105822304-105822326 CAGTGGACGTGGGAGGGGGCAGG + Intergenic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195696221 X:107669589-107669611 AGGGGGATGGGGGAGGAGGAAGG - Intergenic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196424351 X:115555182-115555204 CTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198823936 X:140679127-140679149 CGGGGGTCGGGGGAGGAGGGAGG + Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199411478 X:147528621-147528643 CTGATGGGGGGGGAGGAGGAGGG - Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199491728 X:148407343-148407365 TTGTGGAGGGGGGAGGGGGGAGG + Intergenic
1199860790 X:151798921-151798943 CTGTGGAGAGGGGTGGAGGGAGG + Intergenic
1199895107 X:152119901-152119923 GTGGGGACTGGGGAGGATGAGGG + Intergenic
1199979044 X:152911061-152911083 CTGAGGTTGGGGGAGGAGCAGGG + Intergenic
1200060760 X:153482727-153482749 CTGTTGACGCTGGAGGTGGAAGG + Intronic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1200365449 X:155657649-155657671 CACTGGGCAGGGGAGGAGGATGG + Intronic
1200447175 Y:3277081-3277103 GTGGGGGCGGGGGAGGGGGAAGG + Intergenic
1200774102 Y:7154245-7154267 GTGGGGACGGGGGAGGGGGGAGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic
1202385392 Y:24321833-24321855 GTGTGAGCTGGGGAGGAGGATGG - Intergenic
1202485394 Y:25348295-25348317 GTGTGAGCTGGGGAGGAGGATGG + Intergenic