ID: 1047621957 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:126617013-126617035 |
| Sequence | TTGATCATTTTCTATGGATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047621957_1047621960 | 12 | Left | 1047621957 | 8:126617013-126617035 | CCTGATCCATAGAAAATGATCAA | No data | ||
| Right | 1047621960 | 8:126617048-126617070 | AGCATATTTTCTGTTGGCCATGG | No data | ||||
| 1047621957_1047621959 | 6 | Left | 1047621957 | 8:126617013-126617035 | CCTGATCCATAGAAAATGATCAA | No data | ||
| Right | 1047621959 | 8:126617042-126617064 | GTGCTAAGCATATTTTCTGTTGG | No data | ||||
| 1047621957_1047621961 | 13 | Left | 1047621957 | 8:126617013-126617035 | CCTGATCCATAGAAAATGATCAA | No data | ||
| Right | 1047621961 | 8:126617049-126617071 | GCATATTTTCTGTTGGCCATGGG | No data | ||||
| 1047621957_1047621962 | 26 | Left | 1047621957 | 8:126617013-126617035 | CCTGATCCATAGAAAATGATCAA | No data | ||
| Right | 1047621962 | 8:126617062-126617084 | TGGCCATGGGTCAGTCCAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047621957 | Original CRISPR | TTGATCATTTTCTATGGATC AGG (reversed) | Intergenic | ||