ID: 1047621958

View in Genome Browser
Species Human (GRCh38)
Location 8:126617019-126617041
Sequence TGTGCATTGATCATTTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047621958_1047621962 20 Left 1047621958 8:126617019-126617041 CCATAGAAAATGATCAATGCACA No data
Right 1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG No data
1047621958_1047621960 6 Left 1047621958 8:126617019-126617041 CCATAGAAAATGATCAATGCACA No data
Right 1047621960 8:126617048-126617070 AGCATATTTTCTGTTGGCCATGG No data
1047621958_1047621959 0 Left 1047621958 8:126617019-126617041 CCATAGAAAATGATCAATGCACA No data
Right 1047621959 8:126617042-126617064 GTGCTAAGCATATTTTCTGTTGG No data
1047621958_1047621961 7 Left 1047621958 8:126617019-126617041 CCATAGAAAATGATCAATGCACA No data
Right 1047621961 8:126617049-126617071 GCATATTTTCTGTTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047621958 Original CRISPR TGTGCATTGATCATTTTCTA TGG (reversed) Intergenic