ID: 1047621962

View in Genome Browser
Species Human (GRCh38)
Location 8:126617062-126617084
Sequence TGGCCATGGGTCAGTCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047621958_1047621962 20 Left 1047621958 8:126617019-126617041 CCATAGAAAATGATCAATGCACA No data
Right 1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG No data
1047621957_1047621962 26 Left 1047621957 8:126617013-126617035 CCTGATCCATAGAAAATGATCAA No data
Right 1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047621962 Original CRISPR TGGCCATGGGTCAGTCCAAA AGG Intergenic
No off target data available for this crispr