ID: 1047625042

View in Genome Browser
Species Human (GRCh38)
Location 8:126647726-126647748
Sequence CTTCATGCCCAGAGGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047625042_1047625045 26 Left 1047625042 8:126647726-126647748 CCATGTATCCTCTGGGCATGAAG No data
Right 1047625045 8:126647775-126647797 CTGAACAATGCACTCCTTATTGG No data
1047625042_1047625044 -4 Left 1047625042 8:126647726-126647748 CCATGTATCCTCTGGGCATGAAG No data
Right 1047625044 8:126647745-126647767 GAAGCTACAGCTGTCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047625042 Original CRISPR CTTCATGCCCAGAGGATACA TGG (reversed) Intergenic
No off target data available for this crispr