ID: 1047625044

View in Genome Browser
Species Human (GRCh38)
Location 8:126647745-126647767
Sequence GAAGCTACAGCTGTCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047625042_1047625044 -4 Left 1047625042 8:126647726-126647748 CCATGTATCCTCTGGGCATGAAG No data
Right 1047625044 8:126647745-126647767 GAAGCTACAGCTGTCTACTGTGG No data
1047625041_1047625044 -3 Left 1047625041 8:126647725-126647747 CCCATGTATCCTCTGGGCATGAA No data
Right 1047625044 8:126647745-126647767 GAAGCTACAGCTGTCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047625044 Original CRISPR GAAGCTACAGCTGTCTACTG TGG Intergenic
No off target data available for this crispr