ID: 1047636779

View in Genome Browser
Species Human (GRCh38)
Location 8:126772315-126772337
Sequence TCAGCAAATCAGTGGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047636779_1047636781 -3 Left 1047636779 8:126772315-126772337 CCTGGTTTCCACTGATTTGCTGA No data
Right 1047636781 8:126772335-126772357 TGACTACTTAAACTACTATACGG No data
1047636779_1047636782 10 Left 1047636779 8:126772315-126772337 CCTGGTTTCCACTGATTTGCTGA No data
Right 1047636782 8:126772348-126772370 TACTATACGGTTATCAAAGCAGG No data
1047636779_1047636783 11 Left 1047636779 8:126772315-126772337 CCTGGTTTCCACTGATTTGCTGA No data
Right 1047636783 8:126772349-126772371 ACTATACGGTTATCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047636779 Original CRISPR TCAGCAAATCAGTGGAAACC AGG (reversed) Intergenic
No off target data available for this crispr