ID: 1047638032

View in Genome Browser
Species Human (GRCh38)
Location 8:126787443-126787465
Sequence ATGGGATGATCAGCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047638032_1047638042 4 Left 1047638032 8:126787443-126787465 CCCCACAGAGCTGATCATCCCAT No data
Right 1047638042 8:126787470-126787492 CATGGGAGGACACAGAGAGAAGG 0: 4
1: 66
2: 479
3: 1517
4: 3120
1047638032_1047638043 27 Left 1047638032 8:126787443-126787465 CCCCACAGAGCTGATCATCCCAT No data
Right 1047638043 8:126787493-126787515 CGCCATTTCTATGAACCAGAAGG No data
1047638032_1047638037 -10 Left 1047638032 8:126787443-126787465 CCCCACAGAGCTGATCATCCCAT No data
Right 1047638037 8:126787456-126787478 ATCATCCCATCCACCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047638032 Original CRISPR ATGGGATGATCAGCTCTGTG GGG (reversed) Intergenic
No off target data available for this crispr