ID: 1047638037

View in Genome Browser
Species Human (GRCh38)
Location 8:126787456-126787478
Sequence ATCATCCCATCCACCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047638030_1047638037 25 Left 1047638030 8:126787408-126787430 CCTCATGAATGGAATTGACATCC No data
Right 1047638037 8:126787456-126787478 ATCATCCCATCCACCATGGGAGG No data
1047638031_1047638037 4 Left 1047638031 8:126787429-126787451 CCTTATAAAAGAGACCCCACAGA No data
Right 1047638037 8:126787456-126787478 ATCATCCCATCCACCATGGGAGG No data
1047638029_1047638037 26 Left 1047638029 8:126787407-126787429 CCCTCATGAATGGAATTGACATC No data
Right 1047638037 8:126787456-126787478 ATCATCCCATCCACCATGGGAGG No data
1047638032_1047638037 -10 Left 1047638032 8:126787443-126787465 CCCCACAGAGCTGATCATCCCAT No data
Right 1047638037 8:126787456-126787478 ATCATCCCATCCACCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047638037 Original CRISPR ATCATCCCATCCACCATGGG AGG Intergenic
No off target data available for this crispr