ID: 1047638042

View in Genome Browser
Species Human (GRCh38)
Location 8:126787470-126787492
Sequence CATGGGAGGACACAGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5186
Summary {0: 4, 1: 66, 2: 479, 3: 1517, 4: 3120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047638033_1047638042 3 Left 1047638033 8:126787444-126787466 CCCACAGAGCTGATCATCCCATC No data
Right 1047638042 8:126787470-126787492 CATGGGAGGACACAGAGAGAAGG 0: 4
1: 66
2: 479
3: 1517
4: 3120
1047638034_1047638042 2 Left 1047638034 8:126787445-126787467 CCACAGAGCTGATCATCCCATCC No data
Right 1047638042 8:126787470-126787492 CATGGGAGGACACAGAGAGAAGG 0: 4
1: 66
2: 479
3: 1517
4: 3120
1047638031_1047638042 18 Left 1047638031 8:126787429-126787451 CCTTATAAAAGAGACCCCACAGA No data
Right 1047638042 8:126787470-126787492 CATGGGAGGACACAGAGAGAAGG 0: 4
1: 66
2: 479
3: 1517
4: 3120
1047638032_1047638042 4 Left 1047638032 8:126787443-126787465 CCCCACAGAGCTGATCATCCCAT No data
Right 1047638042 8:126787470-126787492 CATGGGAGGACACAGAGAGAAGG 0: 4
1: 66
2: 479
3: 1517
4: 3120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047638042 Original CRISPR CATGGGAGGACACAGAGAGA AGG Intergenic
Too many off-targets to display for this crispr