ID: 1047642418

View in Genome Browser
Species Human (GRCh38)
Location 8:126834623-126834645
Sequence CACCGTACCCGGCCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642418_1047642426 15 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887
1047642418_1047642424 9 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609
1047642418_1047642429 19 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109
1047642418_1047642430 22 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642418_1047642428 18 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642428 8:126834664-126834686 AACACTTTGGTTGGCCAAGGCGG No data
1047642418_1047642422 5 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642418 Original CRISPR CACCGTACCCGGCCCGGAAC TGG (reversed) Intergenic
No off target data available for this crispr