ID: 1047642420

View in Genome Browser
Species Human (GRCh38)
Location 8:126834629-126834651
Sequence GTGAGCCACCGTACCCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28598
Summary {0: 19, 1: 821, 2: 4761, 3: 10505, 4: 12492}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642420_1047642428 12 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642428 8:126834664-126834686 AACACTTTGGTTGGCCAAGGCGG No data
1047642420_1047642432 27 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642432 8:126834679-126834701 CAAGGCGGGTGGATCACTTGAGG 0: 1786
1: 14578
2: 46718
3: 85156
4: 103958
1047642420_1047642430 16 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642420_1047642426 9 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887
1047642420_1047642424 3 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609
1047642420_1047642429 13 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109
1047642420_1047642422 -1 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642420 Original CRISPR GTGAGCCACCGTACCCGGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr