ID: 1047642421

View in Genome Browser
Species Human (GRCh38)
Location 8:126834634-126834656
Sequence CAGGTGTGAGCCACCGTACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378547
Summary {0: 269, 1: 10900, 2: 59891, 3: 137812, 4: 169675}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642421_1047642429 8 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109
1047642421_1047642426 4 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887
1047642421_1047642424 -2 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609
1047642421_1047642430 11 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642421_1047642432 22 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642432 8:126834679-126834701 CAAGGCGGGTGGATCACTTGAGG 0: 1786
1: 14578
2: 46718
3: 85156
4: 103958
1047642421_1047642422 -6 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863
1047642421_1047642428 7 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642428 8:126834664-126834686 AACACTTTGGTTGGCCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642421 Original CRISPR CAGGTGTGAGCCACCGTACC CGG (reversed) Intergenic
Too many off-targets to display for this crispr