ID: 1047642422

View in Genome Browser
Species Human (GRCh38)
Location 8:126834651-126834673
Sequence CACCTGTAATCCCAACACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 756930
Summary {0: 5278, 1: 86308, 2: 220449, 3: 250032, 4: 194863}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642421_1047642422 -6 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863
1047642420_1047642422 -1 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863
1047642418_1047642422 5 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642422 8:126834651-126834673 CACCTGTAATCCCAACACTTTGG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642422 Original CRISPR CACCTGTAATCCCAACACTT TGG Intergenic
Too many off-targets to display for this crispr