ID: 1047642424

View in Genome Browser
Species Human (GRCh38)
Location 8:126834655-126834677
Sequence TGTAATCCCAACACTTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 746587
Summary {0: 142, 1: 23394, 2: 327621, 3: 259821, 4: 135609}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642418_1047642424 9 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609
1047642421_1047642424 -2 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609
1047642420_1047642424 3 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642424 8:126834655-126834677 TGTAATCCCAACACTTTGGTTGG 0: 142
1: 23394
2: 327621
3: 259821
4: 135609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642424 Original CRISPR TGTAATCCCAACACTTTGGT TGG Intergenic
Too many off-targets to display for this crispr