ID: 1047642426

View in Genome Browser
Species Human (GRCh38)
Location 8:126834661-126834683
Sequence CCCAACACTTTGGTTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333818
Summary {0: 5, 1: 129, 2: 7856, 3: 101941, 4: 223887}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642420_1047642426 9 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887
1047642418_1047642426 15 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887
1047642421_1047642426 4 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642426 8:126834661-126834683 CCCAACACTTTGGTTGGCCAAGG 0: 5
1: 129
2: 7856
3: 101941
4: 223887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642426 Original CRISPR CCCAACACTTTGGTTGGCCA AGG Intergenic
Too many off-targets to display for this crispr