ID: 1047642429

View in Genome Browser
Species Human (GRCh38)
Location 8:126834665-126834687
Sequence ACACTTTGGTTGGCCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277624
Summary {0: 6, 1: 70, 2: 5576, 3: 75863, 4: 196109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642421_1047642429 8 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109
1047642420_1047642429 13 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109
1047642418_1047642429 19 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642429 8:126834665-126834687 ACACTTTGGTTGGCCAAGGCGGG 0: 6
1: 70
2: 5576
3: 75863
4: 196109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642429 Original CRISPR ACACTTTGGTTGGCCAAGGC GGG Intergenic
Too many off-targets to display for this crispr