ID: 1047642430

View in Genome Browser
Species Human (GRCh38)
Location 8:126834668-126834690
Sequence CTTTGGTTGGCCAAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047642421_1047642430 11 Left 1047642421 8:126834634-126834656 CCGGGTACGGTGGCTCACACCTG 0: 269
1: 10900
2: 59891
3: 137812
4: 169675
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642420_1047642430 16 Left 1047642420 8:126834629-126834651 CCGGGCCGGGTACGGTGGCTCAC 0: 19
1: 821
2: 4761
3: 10505
4: 12492
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642418_1047642430 22 Left 1047642418 8:126834623-126834645 CCAGTTCCGGGCCGGGTACGGTG No data
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data
1047642423_1047642430 -8 Left 1047642423 8:126834653-126834675 CCTGTAATCCCAACACTTTGGTT 0: 6
1: 410
2: 26621
3: 331601
4: 259124
Right 1047642430 8:126834668-126834690 CTTTGGTTGGCCAAGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047642430 Original CRISPR CTTTGGTTGGCCAAGGCGGG TGG Intergenic
No off target data available for this crispr