ID: 1047643294

View in Genome Browser
Species Human (GRCh38)
Location 8:126843804-126843826
Sequence CAGTTTGCACAGATGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047643294_1047643304 17 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643304 8:126843844-126843866 CTCTAGCTTCTGGGGAAGAGGGG No data
1047643294_1047643301 9 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643301 8:126843836-126843858 TAACTACTCTCTAGCTTCTGGGG No data
1047643294_1047643299 7 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643299 8:126843834-126843856 CTTAACTACTCTCTAGCTTCTGG No data
1047643294_1047643302 15 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643302 8:126843842-126843864 CTCTCTAGCTTCTGGGGAAGAGG No data
1047643294_1047643303 16 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643303 8:126843843-126843865 TCTCTAGCTTCTGGGGAAGAGGG No data
1047643294_1047643305 30 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643305 8:126843857-126843879 GGAAGAGGGGACACTATAAAAGG No data
1047643294_1047643300 8 Left 1047643294 8:126843804-126843826 CCTGCTTCCATCTGTGCAAACTG No data
Right 1047643300 8:126843835-126843857 TTAACTACTCTCTAGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047643294 Original CRISPR CAGTTTGCACAGATGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr