ID: 1047658447

View in Genome Browser
Species Human (GRCh38)
Location 8:127004916-127004938
Sequence AATATCTACGTTAGGATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047658443_1047658447 -9 Left 1047658443 8:127004902-127004924 CCAACTGGCTCCTTAATATCTAC No data
Right 1047658447 8:127004916-127004938 AATATCTACGTTAGGATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047658447 Original CRISPR AATATCTACGTTAGGATAGA GGG Intergenic
No off target data available for this crispr