ID: 1047668471

View in Genome Browser
Species Human (GRCh38)
Location 8:127118627-127118649
Sequence CAGGGCAAAGCCTCTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047668471_1047668474 -3 Left 1047668471 8:127118627-127118649 CCTGCTTCAGAGGCTTTGCCCTG No data
Right 1047668474 8:127118647-127118669 CTGCTCTTCTCTGCCTCTTGAGG No data
1047668471_1047668477 27 Left 1047668471 8:127118627-127118649 CCTGCTTCAGAGGCTTTGCCCTG No data
Right 1047668477 8:127118677-127118699 CTGCTCTTCTCTGCGTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047668471 Original CRISPR CAGGGCAAAGCCTCTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr