ID: 1047670066

View in Genome Browser
Species Human (GRCh38)
Location 8:127136402-127136424
Sequence CTGGAGACACGGTTTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047670066_1047670068 -8 Left 1047670066 8:127136402-127136424 CCATGTTCAAACCGTGTCTCCAG No data
Right 1047670068 8:127136417-127136439 GTCTCCAGAATCTGTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047670066 Original CRISPR CTGGAGACACGGTTTGAACA TGG (reversed) Intergenic
No off target data available for this crispr