ID: 1047670907

View in Genome Browser
Species Human (GRCh38)
Location 8:127145803-127145825
Sequence ATCTTTTTCTTTAGGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047670907_1047670910 20 Left 1047670907 8:127145803-127145825 CCTCATTACCTAAAGAAAAAGAT No data
Right 1047670910 8:127145846-127145868 TGATTGAATTGAATTTCCTTAGG No data
1047670907_1047670911 21 Left 1047670907 8:127145803-127145825 CCTCATTACCTAAAGAAAAAGAT No data
Right 1047670911 8:127145847-127145869 GATTGAATTGAATTTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047670907 Original CRISPR ATCTTTTTCTTTAGGTAATG AGG (reversed) Intergenic
No off target data available for this crispr