ID: 1047672951

View in Genome Browser
Species Human (GRCh38)
Location 8:127169062-127169084
Sequence TGATAAAACCCTAGTGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047672948_1047672951 -4 Left 1047672948 8:127169043-127169065 CCTCAGGTCAGTTAGGTTCTGAT No data
Right 1047672951 8:127169062-127169084 TGATAAAACCCTAGTGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047672951 Original CRISPR TGATAAAACCCTAGTGGGTT AGG Intergenic
No off target data available for this crispr