ID: 1047672984

View in Genome Browser
Species Human (GRCh38)
Location 8:127169356-127169378
Sequence ATCCATTGGAACCAGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047672984_1047672987 -8 Left 1047672984 8:127169356-127169378 CCCTGGCACTGGTTCCAATGGAT No data
Right 1047672987 8:127169371-127169393 CAATGGATGTTTCAGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047672984 Original CRISPR ATCCATTGGAACCAGTGCCA GGG (reversed) Intergenic
No off target data available for this crispr