ID: 1047674546

View in Genome Browser
Species Human (GRCh38)
Location 8:127185840-127185862
Sequence TTAATTGTGGCCATGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047674546_1047674549 22 Left 1047674546 8:127185840-127185862 CCAAAGCTCATGGCCACAATTAA No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data
1047674546_1047674548 -6 Left 1047674546 8:127185840-127185862 CCAAAGCTCATGGCCACAATTAA No data
Right 1047674548 8:127185857-127185879 AATTAATTGCAAGAGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047674546 Original CRISPR TTAATTGTGGCCATGAGCTT TGG (reversed) Intergenic
No off target data available for this crispr