ID: 1047674547

View in Genome Browser
Species Human (GRCh38)
Location 8:127185853-127185875
Sequence GCTTCTCTTGCAATTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047674547_1047674549 9 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data
1047674547_1047674552 25 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674552 8:127185901-127185923 ACGAAGGAAGAAGTGGAAGGTGG No data
1047674547_1047674550 18 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674550 8:127185894-127185916 TATATACACGAAGGAAGAAGTGG No data
1047674547_1047674551 22 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674551 8:127185898-127185920 TACACGAAGGAAGAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047674547 Original CRISPR GCTTCTCTTGCAATTAATTG TGG (reversed) Intergenic
No off target data available for this crispr